View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15454_low_24 (Length: 384)

Name: NF15454_low_24
Description: NF15454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15454_low_24
NF15454_low_24
[»] chr8 (2 HSPs)
chr8 (104-221)||(27763821-27763941)
chr8 (295-349)||(27763748-27763802)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 27763941 - 27763821
Alignment:
104 taacataatttcaactgcgataatcaaagatcataatgcaaccctagatgtgagcgcgactgcgatttaaaaccttgtttat---atgtataaaatgtag 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||    |||||||||| ||     
27763941 taacataatttcaactgcgacaatcaaagatcataatgcaaccctagatgtgagcacgactatgatttaaaaccttgtttatttgttgtataaaatttaa 27763842  T
201 tcttagtttgcttctttactt 221  Q
    |||||||||||||||||||||    
27763841 tcttagtttgcttctttactt 27763821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 27763802 - 27763748
Alignment:
295 agcatatttgtgcatgttttggattcccacctcattgatggtcataaagagttaa 349  Q
    |||||||||||||||||||||||| | ||||||||||||  |||||||| |||||    
27763802 agcatatttgtgcatgttttggatccacacctcattgataatcataaagtgttaa 27763748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University