View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15454_low_25 (Length: 339)
Name: NF15454_low_25
Description: NF15454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15454_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 135 - 322
Target Start/End: Complemental strand, 11642621 - 11642432
Alignment:
| Q |
135 |
aagaaggctggtgattaagacaaagaaagaagaaaaataaagttg-tgatggtttataaaggttgtatatgatgtatttggatttgtttaatgaagttca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11642621 |
aagaaggctggtgattaagacaaagaaagaagaaaaataaagttggtgatggtttataaaggttgtatatgatgtatttggatttgtttaatgaagttca |
11642522 |
T |
|
| Q |
234 |
tggaagatgatgaagataatgaagattggaagggaagaagaaaagtaaaaataaaataa-atgattttctaggttatgtgacgaaggtga |
322 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11642521 |
tggaagatgatgaagataataaagattgggagggaagaagaaaagtaaaaataaaataagatgattttctaggttatgtgacgaaggtga |
11642432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University