View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15454_low_33 (Length: 250)
Name: NF15454_low_33
Description: NF15454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15454_low_33 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 54 - 250
Target Start/End: Original strand, 37671843 - 37672040
Alignment:
| Q |
54 |
attaatttattttgcctcacccaaccaataagttcaatttttagtgtaaaattaatatta-tcaaatactttttcatagatattaatttattttggctca |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37671843 |
attaatttattttgcctcacccaaccaataagttcaatttttagtgtaaaattaatattaatcaaatactttttcatagatattaatttattttggctca |
37671942 |
T |
|
| Q |
153 |
cccaacaaataagttaagttttagtgtaaaattaatttttcaccgtttattcatatctttatctgtcgtttttcatattggtagattgctatatgaac |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37671943 |
cccaacaaataagttaaattttagtgtaaaattaatttttcaccgtttattcatatctttatctgtcgtttttcatattggtagattgctatatgaac |
37672040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 53 - 109
Target Start/End: Original strand, 37671923 - 37671978
Alignment:
| Q |
53 |
tattaatttattttgcctcacccaaccaataagttcaatttttagtgtaaaattaat |
109 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
37671923 |
tattaatttattttggctcacccaacaaataagtt-aaattttagtgtaaaattaat |
37671978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University