View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15454_low_35 (Length: 231)
Name: NF15454_low_35
Description: NF15454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15454_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 39435934 - 39435870
Alignment:
| Q |
1 |
ttggtagactaaaccactagtttgtctaggttactccaccttgtaatgtaatttagctgtagttg |
65 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
39435934 |
ttggtagactaaatcactagtttgtctaggttactccaccttgtaatgtaatttagttgcagttg |
39435870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 93 - 143
Target Start/End: Complemental strand, 39435845 - 39435795
Alignment:
| Q |
93 |
atactttgtactgtttcctggttagacacacattgtgtttaacttggtcgc |
143 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
39435845 |
atactttgtactgttttctggttagacacacattgtgcttaacttggtcgc |
39435795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 6376845 - 6376808
Alignment:
| Q |
10 |
taaaccactagtttgtctaggttactccaccttgtaat |
47 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6376845 |
taaaccattagtttgtctaggtaactccaccttgtaat |
6376808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University