View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15454_low_35 (Length: 231)

Name: NF15454_low_35
Description: NF15454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15454_low_35
NF15454_low_35
[»] chr8 (2 HSPs)
chr8 (1-65)||(39435870-39435934)
chr8 (93-143)||(39435795-39435845)
[»] chr4 (1 HSPs)
chr4 (10-47)||(6376808-6376845)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 39435934 - 39435870
Alignment:
1 ttggtagactaaaccactagtttgtctaggttactccaccttgtaatgtaatttagctgtagttg 65  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||    
39435934 ttggtagactaaatcactagtttgtctaggttactccaccttgtaatgtaatttagttgcagttg 39435870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 93 - 143
Target Start/End: Complemental strand, 39435845 - 39435795
Alignment:
93 atactttgtactgtttcctggttagacacacattgtgtttaacttggtcgc 143  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||||||    
39435845 atactttgtactgttttctggttagacacacattgtgcttaacttggtcgc 39435795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 6376845 - 6376808
Alignment:
10 taaaccactagtttgtctaggttactccaccttgtaat 47  Q
    ||||||| |||||||||||||| |||||||||||||||    
6376845 taaaccattagtttgtctaggtaactccaccttgtaat 6376808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University