View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_high_16 (Length: 208)
Name: NF15455_high_16
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 8361622 - 8361447
Alignment:
| Q |
19 |
ggataaggcttagtctaggagtatatatag--tgctgatcgcaactttgtgcttgggttgtttttt--gaacctcatctttccattgtcctactctcaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8361622 |
ggataaggcttagtctaggagtatatatataatgctgatcgcaaccttgtgcttgggttgttttttttgaacctcatctttccattgtcctactctcaac |
8361523 |
T |
 |
| Q |
115 |
aagtcaattgggaatggtgtggaaagaaaattgctggtttttggtatggaattggcttttagatgcaggtttccttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8361522 |
aagtcaattgggaatggtgtggaaagaaaattgctgg-ttttggtatggagttggcttttagatgtaggtttccttt |
8361447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 177
Target Start/End: Complemental strand, 8354874 - 8354833
Alignment:
| Q |
136 |
gaaagaaaattgctggtttttggtatggaattggcttttaga |
177 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8354874 |
gaaagaaaattgctggtttttggaatggaattggcttttaga |
8354833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 135
Target Start/End: Complemental strand, 8410812 - 8410769
Alignment:
| Q |
92 |
ctttccattgtcctactctcaacaagtcaattgggaatggtgtg |
135 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8410812 |
ctttccattgtcctactctcaaccagacaattgggaatggtgtg |
8410769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 90 - 135
Target Start/End: Complemental strand, 8355159 - 8355114
Alignment:
| Q |
90 |
atctttccattgtcctactctcaacaagtcaattgggaatggtgtg |
135 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||||||| |||| |
|
|
| T |
8355159 |
atctttccattttcctactctcaagaagacaattgggaatgatgtg |
8355114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 51650279 - 51650325
Alignment:
| Q |
89 |
catctttccattgtcctactctcaacaagtcaattgggaatggtgtg |
135 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51650279 |
catctttccctcgtcctactctcaacaagtcaattggaaatggtgtg |
51650325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University