View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_low_11 (Length: 290)
Name: NF15455_low_11
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 26 - 273
Target Start/End: Original strand, 9098042 - 9098290
Alignment:
| Q |
26 |
agcagagaaccattttgtggagttgaagcgtttctacaactgtagtgatannnnnnnngacctcagtggttattgtaactctagaaaatatattcttgat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9098042 |
agcagagaaccattttgtggagttgaagcgtttctacaactgtagtgatattttttttgacctcagtggttattgtaactttagaaaatatattcttgat |
9098141 |
T |
 |
| Q |
126 |
cccttctagtaatgccactatgttattgtaataatcttgatcagtgtacacattcgcaactctgtatttgttgtctttatctatgtatatgtt-aattgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9098142 |
cccttctagtaatgccactatgttattgtaataatcttgatcaatgtacacattcgcaactctgtatttgttgtctttatctatgtatatgttaaattgt |
9098241 |
T |
 |
| Q |
225 |
atgtcattacttttaaaactaatttggaccacaaaccatatgaccatct |
273 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9098242 |
atgtcattacttttaaaaataatttggaccacaaaccatatgaccatct |
9098290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 135 - 177
Target Start/End: Complemental strand, 9068216 - 9068174
Alignment:
| Q |
135 |
taatgccactatgttattgtaataatcttgatcagtgtacaca |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
9068216 |
taatgccactatgttattgtaataatcttggtcactgtacaca |
9068174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University