View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_low_14 (Length: 243)
Name: NF15455_low_14
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 44177290 - 44177512
Alignment:
| Q |
16 |
ttgattctggtaaaccactcgatgaagcggcgtgggatatggtaagtgccactagtcgtaactaactaactaactaactctactgttatgtgttaatgat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
44177290 |
ttgattctggtaaaccactcgatgaagcggcgtgggatatggtaagtgccactagtcgtaactaa---actaaccaactctactgttatgtgttaatgat |
44177386 |
T |
 |
| Q |
116 |
ttcacactgcaaaattagaatgactttattttaagagtatatccttgtaactttagtactgaattcaaatctc----------gttgtaaaatgatcatt |
205 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44177387 |
ttctcactgcaaaattagaatgactttattttaagagtatatccttgtaactttagtactgaattcaaatctcgttaaagacagttgtaaaatgatcatt |
44177486 |
T |
 |
| Q |
206 |
agtgtcactttagttgatttcatttc |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44177487 |
agtgtcactttagttgatttcatttc |
44177512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 216
Target Start/End: Complemental strand, 41046762 - 41046734
Alignment:
| Q |
188 |
cgttgtaaaatgatcattagtgtcacttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41046762 |
cgttgtaaaatgatcattagtgtcacttt |
41046734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University