View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_low_15 (Length: 242)
Name: NF15455_low_15
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_low_15 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 107 - 242
Target Start/End: Complemental strand, 36943848 - 36943705
Alignment:
| Q |
107 |
tagaaggcgatccaaaaatcacgccggatatccttc---------aacggaatttcactctatccttttgaaattctacctgtaaatggacgtatgcaca |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36943848 |
tagaaggcgatccaaaaatcacgccagatatccttcgacgaactcaacggaatttcactccatccttttgaaattctacctgtaaatggacgtatgcaca |
36943749 |
T |
 |
| Q |
198 |
tgagaaagataataacacttttatccaaaaaatctcacacgtgcc |
242 |
Q |
| |
|
|||||||| || ||||||||||||||| ||||||||||||||||| |
|
|
| T |
36943748 |
tgagaaaggtagtaacacttttatcca-aaaatctcacacgtgcc |
36943705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 22 - 93
Target Start/End: Complemental strand, 36943992 - 36943921
Alignment:
| Q |
22 |
tatgctcacaatgtcctaacaattgttccggacatggctaagacccgctatacgaatgaattcgatcataga |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36943992 |
tatgctcacaatgtcctaacaattgttccggacatggctaagacccgctatacgaatgaattcgatcataga |
36943921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University