View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_low_18 (Length: 236)
Name: NF15455_low_18
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 49685970 - 49685796
Alignment:
| Q |
18 |
cttttgacatcaaaaaagtgtactgtaacttggccttgatgtcgcgttgttgatcacttcagtagttcagtgtactgtagttttgcatgtcctttgtgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49685970 |
cttttgacatcaaaaaagtgtactgtaacttggccttgatgtcgcgttgttgatcacttcagtagttcactgtactgtagttttgcatgtcctttgtgtg |
49685871 |
T |
|
| Q |
118 |
actttattcctgtgctgatgagttagtattcccttaagagggaatttttgcattgaagaatgtaatgaagtatat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49685870 |
tctttattcctgtgctgatgagttagtattcccttaagagggaatttttgcattgaagaatgtaatgaagtatat |
49685796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 92 - 193
Target Start/End: Complemental strand, 8835213 - 8835112
Alignment:
| Q |
92 |
ctgtagttttgcatgtcctt-tgtgtgactttattcctgtgctgatgagttagtattcccttaagagggaatttttgcattgaagaatgtaatgaagtat |
190 |
Q |
| |
|
|||||| ||||||||||||| |||| | ||||||||||||| ||||| |||| |||| | ||||| ||||||| | |||| |||||||||||||| ||| |
|
|
| T |
8835213 |
ctgtagctttgcatgtccttctgtg-gtctttattcctgtggtgatgtgttattatttcgttaagtgggaattatatcattaaagaatgtaatgaaatat |
8835115 |
T |
|
| Q |
191 |
ata |
193 |
Q |
| |
|
||| |
|
|
| T |
8835114 |
ata |
8835112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University