View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_low_20 (Length: 227)
Name: NF15455_low_20
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_low_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 38321837 - 38322063
Alignment:
| Q |
7 |
atcctaactcaactctcctatatccgaaggcacaagtaaagattgcttcctacctatctaatctatgg-catgtttggaacaacgattagtttgacacag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||||||||||| |
|
|
| T |
38321837 |
atcctaactcaactctcctatatccgaaggcacaagtaaagattgcttcctacctatctaatctatcgacatgtttggaacaatgatgagtttgacacag |
38321936 |
T |
 |
| Q |
106 |
tagcaccatgattttgttaaagccctaaacta-----tagtttttgtgtcaaactcaccgtcaatccaaacatgaactatatcttattctaaattaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38321937 |
tagcaccatgattttgttaaagccctaaactaaagtatagtttttgtgtcaaactcaccgtcgatccaaacatgaactatatcttattctaaattaaata |
38322036 |
T |
 |
| Q |
201 |
catcttttaaacttctcaccctcgcca |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38322037 |
catcttttaaacttctcaccctcgcca |
38322063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University