View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15455_low_8 (Length: 337)
Name: NF15455_low_8
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15455_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 2 - 320
Target Start/End: Original strand, 38771036 - 38771356
Alignment:
| Q |
2 |
gtctcagatgatttt-ctagtttgaatggttcgttcaaatcattgcttttagtttcagcttcttctgtttctattttcacctcagctgcaacatcatttt |
100 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| ||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38771036 |
gtctcagatgatttttctagtttgattggttcgttcaactcattgctttttgtttcagcttctggtgtttctatcttcacctcagctgcaacatcatttt |
38771135 |
T |
|
| Q |
101 |
tattttgtttcacaacagttggttcattgattttactagtttcttgtgaagttttcttagcttcttcatgtgtttctgtcttcacaatctcttcagctgc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38771136 |
tattttgtttcacaacagctggttcattgattttactagtttcttgtgaagttttcttagcttcttcatgtgtttctgtcttcacaatctcttcagctgc |
38771235 |
T |
|
| Q |
201 |
tgaatcagtgattttattttgcaatgaaggtttttcctcaacaactgcacattcttgttcagtagatggttcattg-tttttggtttcctgagatggttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38771236 |
tgaatcagtgattttattttgcaatgaaggtttttcctcaacaactgcacattcttgttcagtagatggttcattgttttttggtttcctgagatggttt |
38771335 |
T |
|
| Q |
300 |
ttccaatgttggctcgttgct |
320 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38771336 |
ttccaatgttggctcgttgct |
38771356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University