View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_high_30 (Length: 339)
Name: NF15456_high_30
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 33203645 - 33203950
Alignment:
| Q |
1 |
tacaccgtgccgcgtttcatttcaaagacgcacttcaatctcttctctccggttcaaaccggactaatccaccacgtctttcttccatggtggagattgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
33203645 |
tacaccgtgccgcgtttcatttcaaagacgcacttcaatctcttctctccggttcaaaccggactaatccaccgagactttcatccatggtggagattgt |
33203744 |
T |
 |
| Q |
101 |
tcaaaccataagaaccttcaaggccttttctggaatttcacctattccaatgttttctattttcacaaccaaccaagcgttactcgaagcgttgcatgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33203745 |
tcaaaccataagaaccttcaaggccttttctggaatttcacctattccaatgttttctattttcacaacgaaccaagcgttactcgaagcgttgcatgga |
33203844 |
T |
 |
| Q |
201 |
tcgttatacatgcacgttgttgattttgaaattggtcttggaattcaatacgcttctcttatgaaagagattgctgaaaaagctgttaatggttcgccgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33203845 |
tcgttatacatgcacgttgttgattttgaaattggtcttggaattcaatacgcttctcttatgaaagagattgctgaaaaagctgttaacggttcgccgt |
33203944 |
T |
 |
| Q |
301 |
tgcttc |
306 |
Q |
| |
|
|||||| |
|
|
| T |
33203945 |
tgcttc |
33203950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University