View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_high_33 (Length: 320)
Name: NF15456_high_33
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 42358997 - 42358821
Alignment:
| Q |
19 |
caaaggagaacttgatcttccatatcacctcacctctctcggtttctctttcttttctttt-cctcttcacaaattgcagtgacgaaaattgcagaaatg |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
42358997 |
caaagcagaacttgatcttccatatcacctc-----tctcggtttctctttcttttctttttcctattcacaaattgttgtgacgaaaattgcataaatg |
42358903 |
T |
|
| Q |
118 |
aaacccacaatataaacttctaaaatccacaatctctgattaaaatcttcaaaaaacccaaaaatgcaatgacataaattga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42358902 |
aaacccacaatataaacttctaaaatccacaatctctgattaaaatctttaaaaaacccaaaaatgcaatgacataaattga |
42358821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 197 - 301
Target Start/End: Complemental strand, 42358554 - 42358450
Alignment:
| Q |
197 |
tgagggagtgagatgcaaggtgaaaagtcgaagatgaaagtgaagagaaggggaggtctgggattttgaaggtgaagaacacatggagattatgaatttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358554 |
tgagggagtgagatgcaaggtgaaaagtcgaagatgaaagtgaagagaaggggaggtctgggattttgaaggtgaagaacacatggagattatgaatttt |
42358455 |
T |
|
| Q |
297 |
ggtag |
301 |
Q |
| |
|
||||| |
|
|
| T |
42358454 |
ggtag |
42358450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University