View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_high_42 (Length: 285)
Name: NF15456_high_42
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_high_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 45318757 - 45318483
Alignment:
| Q |
1 |
gctaaaaatgtccatttctcatcgttatattttatgtagtactaatagtaaggaataaggaattgtatggtaatggcaaataccacttgataataagtta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318757 |
gctaaaaatgtccatttctcatcattatattttatgtagtactaatagtaaggaataaggaattgtatggtaatggcaaataccacttgataataagtta |
45318658 |
T |
|
| Q |
101 |
ttaagtttattttcaatatgctcttatcacttcttctatttgtttatttatatgataacatcagcannnnnnnngtctgtttatttatttatataataag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45318657 |
ttaagtttattttcaatatgctcttatcacttcttctatttgtttatttatatgataacatcagcattttttttgtctgtttatttatttatataataag |
45318558 |
T |
|
| Q |
201 |
atcagcatctcttttgacaatatcaagggtgatgccacttgggaggcttaaacgacgtttctcttgtccattcat |
275 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318557 |
attagcatctcttttgacaatatcaagggtgatgccacttgggaggcttaaacgacgtttctcttgtccattcat |
45318483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University