View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_high_49 (Length: 267)
Name: NF15456_high_49
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 26303343 - 26303110
Alignment:
| Q |
12 |
ttatacttaatagctgaatttcttgcaacttaatttaatgcatcaaagttagaatagtatgagctgcatactttatgtgcccatatgtgtaaaga-caca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| | |||| | |||| |
|
|
| T |
26303343 |
ttatacttaatagctgaatttcttgcaacttaatttaatgcatcaaagttagaatagtatgagctacatactttatatgcccataattctaaatatcaca |
26303244 |
T |
 |
| Q |
111 |
ttcaatattgtgtatttaattttgattatgaaaggtgagaccataaatagtagttgatgatgcaggcaatgtgggaagtcattcaagcctgagaaaatgc |
210 |
Q |
| |
|
|| ||| |||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303243 |
ttgaattttgtgtatttaattgtgattatgaaagatgagaccctaaatagtagttgatgatgcaggcaatgtgggaagtcattcaagcctgagaaaatgc |
26303144 |
T |
 |
| Q |
211 |
ataaacacatgaagtcttgtaaaggaatgaaagg |
244 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
26303143 |
acaaacacatgaagtcttgtaaaggaatgaaagg |
26303110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University