View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_high_67 (Length: 225)
Name: NF15456_high_67
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_high_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 13 - 139
Target Start/End: Original strand, 30574231 - 30574359
Alignment:
| Q |
13 |
agatgaaagacatagtaaacaagacagaatgatgttgaaacacattgtac--ggcaaagatcagtgaatcaaagtggttctaggctgtagtagactgtcg |
110 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
30574231 |
agatgaaagacgtagtaaacaagacagaatggtgttgaaacacatagtacagggcaaagatcagtgaatcaaagtggctgtaggctgtagcagactgtcc |
30574330 |
T |
|
| Q |
111 |
ttggaaatagaaaagcagcagatttgtaa |
139 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
30574331 |
ttggaaatagaaaagcagcagacttgtaa |
30574359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 140 - 207
Target Start/End: Original strand, 30570497 - 30570564
Alignment:
| Q |
140 |
atttttctataaggaacatctgatgcatgtgaaactttagcataataactgatgcaaatgttatggtt |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30570497 |
atttttctacaaggaacatctgatgcatgtgaaactttagcataataactgatgcaaatgttatggtt |
30570564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 140 - 205
Target Start/End: Original strand, 30574401 - 30574467
Alignment:
| Q |
140 |
atttttctataaggaacatct-gatgcatgtgaaactttagcataataactgatgcaaatgttatgg |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30574401 |
atttttctataaggaacatcttgatgcatgtgaaactttagcataataacttatgcaaatgttatgg |
30574467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University