View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_high_71 (Length: 216)
Name: NF15456_high_71
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_high_71 |
 | |
|
| [»] scaffold0328 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0328 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 15236 - 15422
Alignment:
| Q |
13 |
tgatgatgatgaccaaccttttgcttctgtgtcatgtatagcaagtccatgtcctctgaacccataacctttagtgttggtacatcatcccagccttctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15236 |
tgatgatgatgaccaaccttttgcttctgtgtcatgtatagcaagtccatgtcctctgaacccataacctttagtgttggtacatcatcccaaccttctt |
15335 |
T |
|
| Q |
113 |
ccaacaatttttggaagagttctttcaaaattccatttccaatgaattcttccactgaaaatgaagccatctttcctttctagaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15336 |
ccaacaatttttggaagagttctttcaaaattccatttccaatgaattcttccactgaaaatgaagccatctttcctttctagaatt |
15422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 178
Target Start/End: Original strand, 27338094 - 27338198
Alignment:
| Q |
74 |
ccataacctttagtgttggtacatcatcccagccttcttccaacaatttttggaagagttctttcaaaattccatttccaatgaattcttccactgaaaa |
173 |
Q |
| |
|
|||||||||| | |||||| ||||||||||| ||||| ||||||||||| ||| || || ||||||| ||||||||| || |||||||| | |||||| |
|
|
| T |
27338094 |
ccataaccttcattgttggcacatcatcccaaccttcatccaacaatttcgggagcagctccttcaaaactccatttcctataaattcttctattgaaaa |
27338193 |
T |
|
| Q |
174 |
tgaag |
178 |
Q |
| |
|
||||| |
|
|
| T |
27338194 |
tgaag |
27338198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University