View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_low_31 (Length: 354)
Name: NF15456_low_31
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 20 - 346
Target Start/End: Original strand, 34826679 - 34827005
Alignment:
| Q |
20 |
aagctaactcaaatcatcttagaacaatcttcattacccacaattttactacactagcctccctagttaaaagagatattgtttggttcattgaaccatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826679 |
aagctaactcaaatcatcttagaacaatcttcattacccacaattttactacactagcctccctagttaaaagagatattgtttggttcattgaaccatc |
34826778 |
T |
 |
| Q |
120 |
cagtcccgcaaccacaagaagaaacaggaattgaaccggcaaatatccatgctttagaccctacaaatgtctaattattcagcggaacagcgattaatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826779 |
cagtcccgcaaccacaagaagaaacaggaattgaaccggcaaatatccatgctttagaccctacaaatgtctaattattcagcggaacagcgattaatca |
34826878 |
T |
 |
| Q |
220 |
gaacagataaaccttgaatatgcacatgaccttatccaagctctcctctctgcctatttcttcatatgcattgttgcatgtatgcagtcttgagcggcta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826879 |
gaacagataaaccttgaatatgcacatgaccttatccaagctctcctctctgcctatttcttcatatgcattgttgcatgtatgcagtcttgagcggcta |
34826978 |
T |
 |
| Q |
320 |
ggcttagtatttttaatttcctttgct |
346 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34826979 |
ggcttagtatttttaatttcctttgct |
34827005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University