View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_low_46 (Length: 277)
Name: NF15456_low_46
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 23 - 258
Target Start/End: Complemental strand, 3501889 - 3501654
Alignment:
| Q |
23 |
tatgctatttctacaagtaggctttttgagattgagttagactctgatcaaaattctatgatggtaaatgttttcaattttcataaaatctctggatatt |
122 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3501889 |
tatgctatttttacaagtaggttttttgagattgagtaagactctgatcaaaattctatgatggtaaatgttttcaattttcacaaaatctctggatatt |
3501790 |
T |
 |
| Q |
123 |
gctaaatgttttgttaaaaatatgatagtttttgtcattgagagactcatattggatagtgatttgacctaactttacaagccgattttgtgaggctgag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3501789 |
gctaaatgttttgttaaaaatatgatagtttttgtcattgagagactcatattggttagtgatttgacctaactttacaagccgattttgtgaggctgag |
3501690 |
T |
 |
| Q |
223 |
gaagacttgaccgaaattctatgatggtatcaaagc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3501689 |
gaagacttgaccgaaattctatgatggtatcaaagc |
3501654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University