View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_low_57 (Length: 254)
Name: NF15456_low_57
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 38 - 239
Target Start/End: Complemental strand, 28928407 - 28928208
Alignment:
| Q |
38 |
tttcaccacattcgtgtctcatattttgtttctacgtgatgcctcaaccacattgcacgctcttgatattcatcacgaagctaacatagagcattgcgcc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
28928407 |
tttcaccacattcgtgtctcatattttgtttctacgtgatgcctcaaccacattgcacgctcttgatattcatcacgaagctaacatagagcgt--cgcc |
28928310 |
T |
 |
| Q |
138 |
tactcagaagatttgtaaaatacgctatttcacataatgtacagcggttacaaatctcgttgttttgtgatattgaacacattccatctcgtgtcttttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28928309 |
tactcagaagatttgtaaaatacgctgtttcacataatgtacagcggttacacatctcgttgttttgtgatattgaacacattccatctcgcatcttttc |
28928210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University