View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_low_63 (Length: 249)
Name: NF15456_low_63
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_low_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 73 - 205
Target Start/End: Original strand, 28929491 - 28929623
Alignment:
| Q |
73 |
cggatgatgggtgcatactcaaccaaacttaatggataccactatattcaccaaaacttattaatccaactacctagaacttattaatccaactaacttt |
172 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28929491 |
cggatgataggtgcatactcaaccaaacttaatggatgccactatgttcaccaaaacttattaatccaactacctagaacttattaatccaactaacttt |
28929590 |
T |
|
| Q |
173 |
taatcaaggttcaccttgtggccagttctttgt |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
28929591 |
taatcaaggttcaccttgtggccaattctttgt |
28929623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University