View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15456_low_65 (Length: 249)

Name: NF15456_low_65
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15456_low_65
NF15456_low_65
[»] scaffold0328 (1 HSPs)
scaffold0328 (1-249)||(15521-15769)


Alignment Details
Target: scaffold0328 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0328
Description:

Target: scaffold0328; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 15521 - 15769
Alignment:
1 cccttcataggttattaaatttaataatatgctttggttatttatggaaacaaattagttaactatgcttttgagaactgcagtggcttaatacctttaa 100  Q
    |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||| ||    
15521 cccttcataggttatttaatttaacaatatgctttggttatttatggaaacaaattagttaactatgcttttgagaactgcagcgggttaatatcttcaa 15620  T
101 attgtttttatttgccggccaaaatctgctcttttgttgcatcaaaattgtcaattacacatgtacttttgtgtcacaagacattggtttcttcccccta 200  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15621 attgtttttatttgccggcgaaaatctgctcttttgttgcatcaaaattgtcaattacacatgtacttttgtgtcacaagacattggtttcttcccccta 15720  T
201 gcataaaccttgaaatcggattttaacccgttcacatcccataaatata 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
15721 gcataaaccttgaaatcggattttaacccgttcacatcccataaatata 15769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University