View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_low_65 (Length: 249)
Name: NF15456_low_65
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_low_65 |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0328 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 15521 - 15769
Alignment:
| Q |
1 |
cccttcataggttattaaatttaataatatgctttggttatttatggaaacaaattagttaactatgcttttgagaactgcagtggcttaatacctttaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||| || |
|
|
| T |
15521 |
cccttcataggttatttaatttaacaatatgctttggttatttatggaaacaaattagttaactatgcttttgagaactgcagcgggttaatatcttcaa |
15620 |
T |
 |
| Q |
101 |
attgtttttatttgccggccaaaatctgctcttttgttgcatcaaaattgtcaattacacatgtacttttgtgtcacaagacattggtttcttcccccta |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15621 |
attgtttttatttgccggcgaaaatctgctcttttgttgcatcaaaattgtcaattacacatgtacttttgtgtcacaagacattggtttcttcccccta |
15720 |
T |
 |
| Q |
201 |
gcataaaccttgaaatcggattttaacccgttcacatcccataaatata |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15721 |
gcataaaccttgaaatcggattttaacccgttcacatcccataaatata |
15769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University