View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15456_low_73 (Length: 220)
Name: NF15456_low_73
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15456_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 45048030 - 45047842
Alignment:
| Q |
17 |
attaaccatacctattcaaactgaagttttgaaagttgtagatatgattggctttcacacatctcgtcttgttttgtttacgtgaa---acatgaatcca |
113 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| || | ||||||| |
|
|
| T |
45048030 |
attaaacatacctattcaaactgaaattttgaaagttgtagatatgattggctttcacacatcttgtcttgttttgtttgtttgtttgcagtcgaatcca |
45047931 |
T |
|
| Q |
114 |
aaagtgtcatagtggatagaattttgggtggccaatattcatgagaatattgtctactaagattcatacgggcttcattcaattcgtct |
202 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45047930 |
aaagtgtcatagtggatagaattttggctggccaatattcattagaatattgcctactaagattcatacgggcttcattcaattcgtct |
45047842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University