View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15457_low_7 (Length: 408)
Name: NF15457_low_7
Description: NF15457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15457_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 183 - 394
Target Start/End: Original strand, 44152470 - 44152688
Alignment:
| Q |
183 |
aaaaaagcaattttgtttggctttaattgaaaagtagaaaactagcggaaccgtggtaaatttaaaaagtggtttgtccattccaagcactttaccggga |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44152470 |
aaaaaagcaattttgtttggctttaattgaaaagtagaaaactagcggaaacgtggtaaatttaaaaagtggtttgtccattccaagcactttaccggga |
44152569 |
T |
|
| Q |
283 |
atttaatttcacttttaactttttc------atatgaatcacggagttagttggtacagttatttatgcatttaat-aaaaaattccgttaaaatactgt |
375 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44152570 |
atttaatttcacttttaactttttcatatgaatatgaatcacggagttagttggtacagttatttatgcatttaataaaaaaattccgttaaaatactgt |
44152669 |
T |
|
| Q |
376 |
gagaaaatgaccgttgatg |
394 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44152670 |
gagaaaatgaccgttgatg |
44152688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 44152306 - 44152408
Alignment:
| Q |
1 |
tgccgctgcttccatcgtgttcagatcacgtgatcctgcttactctaaattgcttctcaatcgtgccgttacggtgcgtcgctttcgttcccagtccatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44152306 |
tgccgctgcttccatcgtgttcagatcacgtgatcctgcttactctaaattgcttctcaatcgtgccgttacggtgcgtcgctttcgttcccagtccatg |
44152405 |
T |
|
| Q |
101 |
caa |
103 |
Q |
| |
|
||| |
|
|
| T |
44152406 |
caa |
44152408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University