View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15458_high_17 (Length: 240)
Name: NF15458_high_17
Description: NF15458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15458_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 139 - 204
Target Start/End: Complemental strand, 10463303 - 10463238
Alignment:
| Q |
139 |
cccgaaatttaatgggacaggtgagatttaatacgtagcgttatttgttacatttatttcaattcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10463303 |
cccgaaatttaatgggacaggtgagatttaatacgtagcgttatttgttacatttatttcaattcc |
10463238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 10463410 - 10463367
Alignment:
| Q |
43 |
cactcgaatcgctacagcaacttggcatttttgtcattatattt |
86 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10463410 |
cactcgaatcactacagcaacttggcatttttgtcattatattt |
10463367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University