View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15458_low_29 (Length: 206)

Name: NF15458_low_29
Description: NF15458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15458_low_29
NF15458_low_29
[»] chr3 (1 HSPs)
chr3 (1-206)||(42182549-42182757)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 42182757 - 42182549
Alignment:
1 ttgttatattataccaatagtaaaaagaatcaaccaccaaaattaactttttcaggtaaggaagatagtgctgtttctaaataggagtaggggtaatgaa 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42182757 ttgttatattatgccaatagtaaaaagaatcaaccaccaaaattaactttttcaggtaaggaagatagtgctgtttctaaataggagtaggggtaatgaa 42182658  T
101 atgataatgaatatgatatgataatatat---agtatagtagtacagcaacaaaggctaggcttgaggcatgtaaagaagacaggtgttggaatggagag 197  Q
    ||||||||| |||||||||| ||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42182657 atgataatgcatatgatatggtaatatatagtagtatagtagtacagcaacaaaggctaggcttgaggcatgtaaagaagacaggtgttggaatggagag 42182558  T
198 atttatgat 206  Q
    |||||||||    
42182557 atttatgat 42182549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University