View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15458_low_8 (Length: 383)
Name: NF15458_low_8
Description: NF15458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15458_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 6 - 373
Target Start/End: Complemental strand, 38581670 - 38581303
Alignment:
| Q |
6 |
aatctgaatatgaattcaccattttgaaagaagaatttgatggtcaaaatcctccagtccttgatagacctttgcagggtgaagatctcatatacatgaa |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38581670 |
aatctgaatatgaattcaccattgtgaaagaagaatttgatggtcaaaatcctccagtccttgatagagctttgcagggtgaagatctcatatacatgaa |
38581571 |
T |
 |
| Q |
106 |
ggtgagtttaattgttcctcttttttgtgtatgtgataaatctgaagatcctagctgtcttgtaaattgtattctatgccacctatagtcacaacaacta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581570 |
ggtgagtttaattgttcctcttttttgtgtatgtgataaatctgaagatcctagctgtcttgtaaattgtattctatgccacctatagtcacaacaacta |
38581471 |
T |
 |
| Q |
206 |
gtgctcaacagctcaagtataaaagtggtgtttcttggccccaaaggaaacttaacactttatttgaacttgggatagagaatgaaattgtgtcctcatt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581470 |
gtgctcaacagctcaagtataaaagtggtgtttcttggccccaaaggaaacttaacactttatttgaacttgggatagagaatgaaattgtgtcctcatt |
38581371 |
T |
 |
| Q |
306 |
caagttagttttatttactgctcattgtgaaatgtaccttatatctctgaaaaaactctgcatctctg |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38581370 |
caagttagttttatttactgctcattgtgaaatgtaccttatatctctgaaaagactctgcatctctg |
38581303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University