View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_high_20 (Length: 429)
Name: NF1545_high_20
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 244 - 419
Target Start/End: Complemental strand, 12627068 - 12626891
Alignment:
| Q |
244 |
gttggttttaatagcagctgggttagatgtctgaaatgccaaatccattaaatgttgcgtgtatctattcatcaaaattctgtgaagttcctgatgaatt |
343 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
12627068 |
gttggttttaacagcagctaggttagatgtcggaaatgccaattccattaaatgttgcgtgtatctattcatcaaaattatgtgaagtttcagatgaatt |
12626969 |
T |
|
| Q |
344 |
gaaccaacctctcatcccatattctagttattgcatttctttctcacgcaaagaaattt--aataactatatcttcat |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12626968 |
gaaccaacctctcatcccatattctagttattgcatttctttctcacgcaaagaaatttgcaataactatatcttcat |
12626891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 12633911 - 12633759
Alignment:
| Q |
1 |
atacacttgcagattcatatcaggcgtcgactccgatctagccaaaaaggtgctcgaaggaccgaacccaaaatggaaacacacaaacgaacatagatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||| |||||||| |
|
|
| T |
12633911 |
atacacttgcagattcatatcaggcgtcgactccgatctagccaaaaaggtgctcgaaggaccgagcccaaaatagaaacacaaaaacgaaaatagatcc |
12633812 |
T |
|
| Q |
101 |
caccaaacaacgcagcaacgacaacgtgggcagattcaaaggtcgcggcggcg |
153 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12633811 |
caccaaacaacgcagcaatgacaacgtgggcagattcaaaggtcgcggcggcg |
12633759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 196 - 253
Target Start/End: Complemental strand, 12627313 - 12627256
Alignment:
| Q |
196 |
cattattgttttcttttcgggacatatatatggaccacacaattttaagttggtttta |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12627313 |
cattattgttttcttttcgggacatatatatggaccactcaatcttaagttggtttta |
12627256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University