View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_high_23 (Length: 388)
Name: NF1545_high_23
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 226 - 374
Target Start/End: Complemental strand, 45012738 - 45012590
Alignment:
| Q |
226 |
aattgacatgaaacacatgaaatctatttcttcccatattggcttgccttatatttttcttcccctcaatttgtagggtatacaatagagtagataatct |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45012738 |
aattgacatgaaacacatgaaatctatttcttcccatattggcttgccttttatttttcttcccctcaatttgtagggtatacaatagagtagataatct |
45012639 |
T |
 |
| Q |
326 |
taattagctagttactcttttacccctttttatttcaacatgttgttga |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45012638 |
taattagctagttactcttttacccctttttatttcaacatgttgttga |
45012590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 45012831 - 45012734
Alignment:
| Q |
7 |
atgaccttttttgatattatatttgagattggcaggagtacttctagaataaaagacaccacattagttggatatgcgtataattaacaatgcaattg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45012831 |
atgaccttttttgatattatatttgagattggcaggagtacttctagaataaaagacaccacattagttggatatgcgtataattaacaatgcaattg |
45012734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University