View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1545_high_39 (Length: 282)

Name: NF1545_high_39
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1545_high_39
NF1545_high_39
[»] chr7 (1 HSPs)
chr7 (13-246)||(40230456-40230689)


Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 40230456 - 40230689
Alignment:
13 aatatacgggttaataaacaaaatgcaaaacatagacaaaattgagtatatgggtcacataaaaaattgagtatacgagtgacacgttttatataccttt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40230456 aatatacgggttaataaacaaaatgcaaaacatagacaaaattgagtatatgggtcacataaaaaattgagtatacgagtgacacgttttatataccttt 40230555  T
113 catctaattgaataatcaaattattgtcgattgcgaaattaagatgatcaattattctaaaagatcaatcagaccgacatatgagttaataatcagacaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||    
40230556 catctaattgaataatcaaattattgtcgattgcgaaattaagatgatcaattattctaaaagatcagtcagagcgacatataagttaataatcagacaa 40230655  T
213 tcataaaacattgacaatgtatcttaactcacaa 246  Q
    |||||||||||||| |||||||||||||||||||    
40230656 tcataaaacattgagaatgtatcttaactcacaa 40230689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University