View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_high_53 (Length: 238)
Name: NF1545_high_53
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 174
Target Start/End: Complemental strand, 44000851 - 44000695
Alignment:
| Q |
17 |
agtatcttcaccggtaacctacacaaaatttcttccacgagttcagacggaagagtgggtagagaaggtgatgatagggttccagcggaggtagagaaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44000851 |
agtatcttcaccggtaacctacacaaaatttcttct-cgagttcagacggaagaatgggtagcgaaggtgatgataggattccagcggaggtagagaaac |
44000753 |
T |
|
| Q |
117 |
gcagcggcatggagcaacagtacgagagaaacagaacggtgaatgttgttataaaaac |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44000752 |
gcagtggcatggagcaacagtacgagagaaacagaacgatgaatgttgttataaaaac |
44000695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 43996873 - 43996812
Alignment:
| Q |
17 |
agtatcttcaccggtaacctacacaaaatttcttccacgagttcagacggaagagtgggtag |
78 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
43996873 |
agtatcttcaccggtaacctgcacaatatttcttccacaagttcagaccgaagagtaggtag |
43996812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 43991293 - 43991233
Alignment:
| Q |
17 |
agtatcttcaccggtaacctacacaaaatttcttccacgagttcagacggaagagtgggta |
77 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
43991293 |
agtatcttcaccggtaatctacacaggatttcttccacaagttcaaacggaagagtgggta |
43991233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University