View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_low_22 (Length: 441)
Name: NF1545_low_22
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_low_22 |
 |  |
|
| [»] scaffold0066 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 31932 - 32196
Alignment:
| Q |
1 |
cattgatttaatattaaatcaatgtaaaattgatgatgatgtaatatcacatcactgtaattatatataagggttgacataacatcttgaaacaaatttg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31932 |
cattgatttaacattaaatcaatgtaaaattgatgatgatgtaatatcacaacactgtaattatatataagggttgacataacagcttgaaacaaatttg |
32031 |
T |
 |
| Q |
101 |
ttgaacgggttttgcttgctagttaaaaatctcttcgattttagttatgnnnnnnnaactgacttctatgaagatttgaaagaatacacttattcattct |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32032 |
ttgaacaggttttgcttgctagttaaaaatatctttgattttagttatgtttttttaactgacttctatgaagatttgttagaatacgcttattcattct |
32131 |
T |
 |
| Q |
201 |
ttaggagtatttaaatgattggtaaatagaatcttcttaagtaaacgctaaggagtgtttatctt |
265 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32132 |
ttaggagtatttaaataattggtaaatagaaacttcttaagtaaacgctaaggagtgtttatctt |
32196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 336 - 424
Target Start/End: Original strand, 32267 - 32355
Alignment:
| Q |
336 |
tattcaccatcgtccataccttgaggataacttgtgaaccatctagtgtctcaacactaatctcaataacagtcggcaaaactgcaaag |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267 |
tattcaccatcgtccataccttgaggataacttgtgaaccatctggtgtctcaacactaatctcaataacagtcggcaaaactgcaaag |
32355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University