View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_low_59 (Length: 247)
Name: NF1545_low_59
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 43933314 - 43933543
Alignment:
| Q |
1 |
taaaacataattaatccataattgtatcacttatgcatcataaaattggcttctattttaatatagacaaaattatgtttgaggtcctctaagttatacc |
100 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43933314 |
taaaaaataattaacccataattgtatcacttatgcatcatagaattggcttctattttaatatagacaaaattatgtttgaggtcctctaagttagacc |
43933413 |
T |
 |
| Q |
101 |
annnnnnnnattgttcaagttttattttactaaaattagtcatttatgttatgctgcaaagcccatatactttaaaatagatgatgtaccaacatctgat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
43933414 |
attttttttattgttcaagttttattttactaaaattagtcatttatgttatgctgcaaagcccatatactttaaaataaatgacgtaccaacatctgat |
43933513 |
T |
 |
| Q |
201 |
acgtatcttacactaacatctgcctgatat |
230 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
43933514 |
acgtatcttgcactaacatctgcctgatat |
43933543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University