View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_low_67 (Length: 216)
Name: NF1545_low_67
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 13152534 - 13152344
Alignment:
| Q |
17 |
agtgatttcacaaaatccagacccatgcacgcagattatgtgtataaattgtcgtctagcttgttgtatgtagcagtactttttctatcaactaacgtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13152534 |
agtgatttcacaaaatccagacccatgcacgcagattatgtgtataaattgtcgtctagcttgttgtatgtagcagtactttttctatcaactaacgtga |
13152435 |
T |
|
| Q |
117 |
tcatacacttcatctctgcctagggagtgatgtgaaaattatatacattannnnnnnacataagatgaaaattatatgcatgtgatgatgt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13152434 |
tcatacacttcatctctgcctagggagtgatgtgaaaattatatacattatttttttacataagatgaaaattatatgcatgtgatgatgt |
13152344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University