View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1545_low_70 (Length: 209)
Name: NF1545_low_70
Description: NF1545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1545_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 52835421 - 52835627
Alignment:
| Q |
1 |
gattatggttgcataattcgatgatactgtcaaagttgc-------------ttgcactatacaagatgcttattttgttcccttctcccaaaataaatg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52835421 |
gattatggttgcataattcgatgatactgtcaaagttgcaggattaagctgcttgcactatacaagatgcttattttgttcccttctcccaaaataaatg |
52835520 |
T |
 |
| Q |
88 |
aga--cttttaaacagatgagatactatactctaataattggtaggaaaactatcttttaaccaaatacaccaccacatgtctgaaaaagaccaaagctc |
185 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52835521 |
agagacttttaaatagatgagatactatactctaatagttggtaggaaaactatcttttaaccaaatacaccaccacatgtctgaaaaagaccaaagctc |
52835620 |
T |
 |
| Q |
186 |
tcgatca |
192 |
Q |
| |
|
| ||||| |
|
|
| T |
52835621 |
ttgatca |
52835627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University