View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15461_high_12 (Length: 319)
Name: NF15461_high_12
Description: NF15461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15461_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 302
Target Start/End: Complemental strand, 36458628 - 36458344
Alignment:
| Q |
18 |
acagtggagtttcttgggttacatttcacagctcatatgattttgggtatctagttaagattttgactcagaattacttaccgtctcgattggaggaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458628 |
acagtggagtttcttgggttacatttcacagctcatatgattttgggtatctagttaagattttgactcagaattacttaccgtctcgattggaggaatt |
36458529 |
T |
 |
| Q |
118 |
cttaagcatcttaacg-aaatattttggacggaatgtctatgatatgaagtatatgatcaaattctgcaacttatatggtggtctggaacgtgttgccac |
216 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458528 |
cttaagcatcttaacacaaatattt-ggacagaatgtctatgatatgaagtatatgatcaaattctgcaacttatatggtggtctggaacgtgttgccac |
36458430 |
T |
 |
| Q |
217 |
taaactcaaggtcagccgggcggtcggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458429 |
taaactcaaggtcagccgggcggtcggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatga |
36458344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 304
Target Start/End: Complemental strand, 40871718 - 40871656
Alignment:
| Q |
242 |
ggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatgatg |
304 |
Q |
| |
|
||||| || |||||||| | ||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
40871718 |
ggaaagtcgcatcaagctggatcagatagtttgttgacatggcatgcatttaagaaaatgatg |
40871656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 304
Target Start/End: Complemental strand, 40874816 - 40874754
Alignment:
| Q |
242 |
ggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatgatg |
304 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||||||| ||||| || |||||||| |||||| |
|
|
| T |
40874816 |
ggaaagtctcatcaagctggatcagatagtttgttgacgtggcatgcatttaagaaaatgatg |
40874754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University