View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15461_low_21 (Length: 235)
Name: NF15461_low_21
Description: NF15461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15461_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 37598166 - 37597940
Alignment:
| Q |
1 |
catttagtctttgtagtgtacttcctctaaagtgctggaaagtttataagttactgttaagtgttaaggttttggaagaactttttgaaggattgactga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37598166 |
catttagtctttgtagtgtacttcctctaaagtgctggaaagtttataagttactgttaagtgttaaggttttggaagaactttttgaaggattgactga |
37598067 |
T |
|
| Q |
101 |
ttccactggtccttgtatttaattttgctgatg---gtagatgcaatatggaaagagactcctaacgcactg------atatgcactagaaatatcgtta |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
37598066 |
ttccactggtccttgtatttaattttgctgatggtagtagatgcaatatggaaagagactcctaacgcactgatatatatatgcactagaaatatcgtaa |
37597967 |
T |
|
| Q |
192 |
cagttttgatgggccatacctgcctca |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37597966 |
cagttttgatgggccatacctgcctca |
37597940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University