View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15462_low_11 (Length: 211)
Name: NF15462_low_11
Description: NF15462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15462_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 4477802 - 4477982
Alignment:
| Q |
15 |
tatatattttattaaaacattttgtatcaaaatttgaaatgccagttaactatgataagtaattgtcctatcttttgaaactgcaaatctttcatgcaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4477802 |
tatatattttattaaaacattttgtatcaaaatttgaaatgccagttaactatgataagtaattgtcctatcttttgaaactgcaaatctttcatgcaaa |
4477901 |
T |
 |
| Q |
115 |
atccaaatggaaccatactgctccatctgtgaacttgttgtcacaagcaaaaataaggctgaaaaagaagagtgtggaaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4477902 |
atccaaatggaaccatactgctccatctgtgaacttgttgtcacaagcaaaaataaggctgaaaaagaagagtatggaaag |
4477982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University