View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15462_low_3 (Length: 423)
Name: NF15462_low_3
Description: NF15462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15462_low_3 |
 |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 37)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 3152090 - 3151975
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3152090 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaattttttgtttttgaaaatagtctctgacccca |
3151991 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3151990 |
cttttgtgatgatttg |
3151975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 28427587 - 28427472
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28427587 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtctctgacccca |
28427488 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28427487 |
cttttgtgatgatttg |
28427472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 8510316 - 8510351
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8510316 |
gaaaatagtctctgaccccacttttgtgatgatttg |
8510351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 12673904 - 12673869
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12673904 |
gaaaatagtctctgaccccacttttgtgatgatttg |
12673869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 16123242 - 16123277
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16123242 |
gaaaatagtctctgaccccacttttgtgatgatttg |
16123277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 10976999 - 10977114
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
10976999 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttctggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
10977098 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10977099 |
cttttgtgatgatttg |
10977114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 20907436 - 20907321
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20907436 |
cctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
20907337 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20907336 |
cttttgtgatgatttg |
20907321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 275543 - 275578
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
275543 |
gaaaatagtccctgaccccacttttgtgatgatttg |
275578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 7518346 - 7518311
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7518346 |
gaaaatagtctctggccccacttttgtgatgatttg |
7518311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 13584105 - 13584140
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13584105 |
gaaaatagtccctgaccccacttttgtgatgatttg |
13584140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 19656802 - 19656767
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19656802 |
gaaaatagtccctgaccccacttttgtgatgatttg |
19656767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 22156031 - 22156066
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22156031 |
gaaaatagtccctgaccccacttttgtgatgatttg |
22156066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 29955400 - 29955435
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29955400 |
gaaaatagtccctgaccccacttttgtgatgatttg |
29955435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 30004554 - 30004589
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30004554 |
gaaaatagtccctgaccccacttttgtgatgatttg |
30004589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 30130258 - 30130293
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30130258 |
gaaaatagtctctggccccacttttgtgatgatttg |
30130293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 289 - 324
Target Start/End: Original strand, 35565589 - 35565624
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctgg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35565589 |
cctgcaaatatgcctcattttggttttagtctctgg |
35565624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 37506968 - 37507003
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37506968 |
gaaaatagtccctgaccccacttttgtgatgatttg |
37507003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 39288798 - 39288763
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39288798 |
gaaaatagtccctgaccccacttttgtgatgatttg |
39288763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 39437007 - 39436972
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39437007 |
gaaaatagtccctgaccccacttttgtgatgatttg |
39436972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 45320879 - 45320844
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45320879 |
gaaaatagtccctgaccccacttttgtgatgatttg |
45320844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 50261839 - 50261804
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50261839 |
gaaaatagtctctgactccacttttgtgatgatttg |
50261804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 3830155 - 3830185
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3830155 |
cctgcaaatatgcctcattttggttttagtc |
3830185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 288 - 318
Target Start/End: Complemental strand, 12673961 - 12673931
Alignment:
| Q |
288 |
tcctgcaaatatgcctcattttggttttagt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12673961 |
tcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 19844560 - 19844530
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19844560 |
cctgcaaatatgcctcattttggttttagtc |
19844530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 28942627 - 28942661
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
28942627 |
aaaatagtctctgatcccacttttgtgatgatttg |
28942661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 325
Target Start/End: Complemental strand, 28942885 - 28942848
Alignment:
| Q |
288 |
tcctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
28942885 |
tcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 319
Target Start/End: Complemental strand, 30130482 - 30130453
Alignment:
| Q |
290 |
ctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30130482 |
ctgcaaatatgcctcattttggttttagtc |
30130453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 369 - 402
Target Start/End: Complemental strand, 40169552 - 40169519
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatt |
402 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
40169552 |
gaaaatagtccctgaccccacttttgtgatgatt |
40169519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Original strand, 51834629 - 51834696
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
51834629 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaattttgtttttggtccctgcaaaa |
51834696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 8510235 - 8510271
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
8510235 |
cctgcaaatatgcctctttttggttttagtccctggt |
8510271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 10977320 - 10977284
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10977320 |
cctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 20612877 - 20612841
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20612877 |
cctgcaaatatgcctcgttttggttttagtccctggt |
20612841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 22156272 - 22156236
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
22156272 |
cctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 401
Target Start/End: Complemental strand, 25710771 - 25710739
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgat |
401 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
25710771 |
gaaaatagtctctgactccacttttgtgatgat |
25710739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 37506888 - 37506924
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
37506888 |
cctgcaaatatgcctcgttttggttttagtccctggt |
37506924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 39288877 - 39288841
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39288877 |
cctgcaaatatgcctcgttttggttttagtccctggt |
39288841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 39437088 - 39437052
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39437088 |
cctgcaaatatgcctcgttttggttttagtccctggt |
39437052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 25)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 7155818 - 7155933
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
7155818 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtttctgacccca |
7155917 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7155918 |
cttttgtgatgatttg |
7155933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 5286930 - 5286863
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
5286930 |
cctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaa |
5286863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 15076183 - 15076068
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15076183 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
15076084 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
15076083 |
cttttatgatgatttg |
15076068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 31166891 - 31167006
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31166891 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
31166990 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
31166991 |
cttttgtgattatttg |
31167006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 32885694 - 32885809
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||| ||| | |
|
|
| T |
32885694 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtctctgccccta |
32885793 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32885794 |
cttttgtgatgatttg |
32885809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 33801722 - 33801607
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33801722 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaatttttttgtttttgaaaatagtccctgacccca |
33801623 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33801622 |
cttttgtgatgatttg |
33801607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 8680877 - 8680912
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8680877 |
gaaaatagtccctgaccccacttttgtgatgatttg |
8680912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 11129302 - 11129337
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11129302 |
gaaaatagtccctgaccccacttttgtgatgatttg |
11129337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 14655669 - 14655634
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14655669 |
gaaaatagtccctgaccccacttttgtgatgatttg |
14655634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 17321453 - 17321418
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17321453 |
gaaaatagtccctgaccccacttttgtgatgatttg |
17321418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 17321586 - 17321551
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17321586 |
gaaaatagtccctgaccccacttttgtgatgatttg |
17321551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 17772014 - 17772049
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17772014 |
gaaaatagtctctgaccccatttttgtgatgatttg |
17772049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 24273939 - 24273974
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24273939 |
gaaaatagtccctgaccccacttttgtgatgatttg |
24273974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 30928944 - 30928909
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30928944 |
gaaaatagtccctgaccccacttttgtgatgatttg |
30928909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 31398440 - 31398405
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31398440 |
gaaaatagtccctgaccccacttttgtgatgatttg |
31398405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 317911 - 317945
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
317911 |
aaaatagtctctgatcccacttttgtgatgatttg |
317945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 14428751 - 14428785
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14428751 |
aaaatagtctctgaccccatttttgtgatgatttg |
14428785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 403
Target Start/End: Complemental strand, 19296305 - 19296271
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgattt |
403 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
19296305 |
gaaaatagtccctgaccccacttttgtgatgattt |
19296271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 21385563 - 21385533
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21385563 |
cctgcaaatatgcctcattttggttttagtc |
21385533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 401
Target Start/End: Complemental strand, 494661 - 494629
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgat |
401 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
494661 |
gaaaatagtccctgaccccacttttgtgatgat |
494629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 543382 - 543418
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
543382 |
cctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 7156139 - 7156103
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
7156139 |
cctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 8680796 - 8680832
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
8680796 |
cctgcaaatatgcctcgttttggttttagtccctggt |
8680832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 12419917 - 12419881
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
12419917 |
cctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 24274110 - 24274074
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
24274110 |
cctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 31)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 51709006 - 51708891
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
51709006 |
cctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgatccca |
51708907 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51708906 |
cttttgtgatgatttg |
51708891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 27008306 - 27008271
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008306 |
gaaaatagtctctgaccccacttttgtgatgatttg |
27008271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 50714544 - 50714429
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
50714544 |
cctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
50714445 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50714444 |
cttttgtgatgatttg |
50714429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 123555 - 123591
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
123555 |
cctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 50714261 - 50714297
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50714261 |
cctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 9446223 - 9446188
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9446223 |
gaaaatagtccctgaccccacttttgtgatgatttg |
9446188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 13479371 - 13479406
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13479371 |
gaaaatagtccctgaccccacttttgtgatgatttg |
13479406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 18136014 - 18135979
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18136014 |
gaaaatagtcactgaccccacttttgtgatgatttg |
18135979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 27427944 - 27427979
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27427944 |
gaaaatagtccctgaccccacttttgtgatgatttg |
27427979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 36702101 - 36702136
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36702101 |
gaaaatagtccctgaccccacttttgtgatgatttg |
36702136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 49123222 - 49123187
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49123222 |
gaaaatagtcactgaccccacttttgtgatgatttg |
49123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 55482369 - 55482334
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55482369 |
gaaaatagtccctgaccccacttttgtgatgatttg |
55482334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 123877 - 123847
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
123877 |
cctgcaaatatgcctcattttggttttagtc |
123847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 2180241 - 2180271
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2180241 |
cctgcaaatatgcctcattttggttttagtc |
2180271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 325
Target Start/End: Original strand, 6827569 - 6827603
Alignment:
| Q |
291 |
tgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
6827569 |
tgcaaatatgcctcgttttggttttagtcgctggt |
6827603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 11285605 - 11285639
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11285605 |
aaaatagtctctgaccccatttttgtgatgatttg |
11285639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 14791520 - 14791550
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14791520 |
cctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 22099809 - 22099775
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22099809 |
aaaatagtctctgaccccatttttgtgatgatttg |
22099775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 36054129 - 36054099
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36054129 |
cctgcaaatatgcctcattttggttttagtc |
36054099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 46292630 - 46292600
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46292630 |
cctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 54208482 - 54208512
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54208482 |
cctgcaaatatgcctcattttggttttagtc |
54208512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 371 - 404
Target Start/End: Original strand, 13064260 - 13064293
Alignment:
| Q |
371 |
aaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
13064260 |
aaatagtccctgaccccacttttgtgatgatttg |
13064293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 318
Target Start/End: Complemental strand, 51763181 - 51763152
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51763181 |
cctgcaaatatgcctcattttggttttagt |
51763152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 6827853 - 6827817
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
6827853 |
cctgcaaatatgcctcgttttggttttagtccctggt |
6827817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 404
Target Start/End: Complemental strand, 12152384 - 12152356
Alignment:
| Q |
376 |
gtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12152384 |
gtctctgaccccacttttgtgatgatttg |
12152356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 15555524 - 15555560
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
15555524 |
cctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 401
Target Start/End: Complemental strand, 29420436 - 29420404
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgat |
401 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
29420436 |
gaaaatagtctctaaccccacttttgtgatgat |
29420404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 35415612 - 35415576
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35415612 |
cctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 35763668 - 35763704
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35763668 |
cctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 41345874 - 41345910
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
41345874 |
cctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 41619920 - 41619956
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
41619920 |
cctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 29)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 38980232 - 38980117
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38980232 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
38980133 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38980132 |
cttttgtgatgatttg |
38980117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 7814505 - 7814470
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7814505 |
gaaaatagtctctgaccccacttttgtgatgatttg |
7814470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 7814638 - 7814603
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7814638 |
gaaaatagtctctgaccccacttttgtgatgatttg |
7814603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 8046430 - 8046465
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046430 |
gaaaatagtctctgaccccacttttgtgatgatttg |
8046465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 369 - 403
Target Start/End: Original strand, 10665084 - 10665118
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgattt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10665084 |
gaaaatagtctctgaccccacttttgtgatgattt |
10665118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 24483500 - 24483534
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24483500 |
aaaatagtctctgaccccacttttgtgatgatttg |
24483534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 37272081 - 37271966
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37272081 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccatgacccca |
37271982 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37271981 |
cttttgtgatgatttg |
37271966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 405
Target Start/End: Complemental strand, 14393029 - 14392993
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttgt |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14393029 |
gaaaatagtccctgaccccacttttgtgatgatttgt |
14392993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 19183884 - 19183919
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19183884 |
gaaaatagtccctgaccccacttttgtgatgatttg |
19183919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 23989937 - 23989972
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23989937 |
gaaaatagtccctgaccccacttttgtgatgatttg |
23989972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 26814127 - 26814092
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26814127 |
gaaaatagtccctgaccccacttttgtgatgatttg |
26814092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 40302077 - 40302112
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40302077 |
gaaaatagtccctgaccccacttttgtgatgatttg |
40302112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 41693901 - 41693866
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41693901 |
gaaaatagtccctgaccccacttttgtgatgatttg |
41693866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 41791119 - 41791154
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41791119 |
gaaaatagtccctgaccccacttttgtgatgatttg |
41791154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 43789090 - 43789055
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43789090 |
gaaaatagtccctgaccccacttttgtgatgatttg |
43789055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 44985722 - 44985757
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44985722 |
gaaaatagtccctgaccccacttttgtgatgatttg |
44985757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 3172041 - 3172071
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3172041 |
cctgcaaatatgcctcattttggttttagtc |
3172071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 7814716 - 7814686
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7814716 |
cctgcaaatatgcctcattttggttttagtc |
7814686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 12835346 - 12835376
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12835346 |
cctgcaaatatgcctcattttggttttagtc |
12835376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 288 - 356
Target Start/End: Complemental strand, 17912791 - 17912723
Alignment:
| Q |
288 |
tcctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
17912791 |
tcctgcaaatatgcctcgttttggttttagtctctggtaaaaaaaaatttgtttttggtccctgcaaaa |
17912723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 32476116 - 32476146
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32476116 |
cctgcaaatatgcctcattttggttttagtc |
32476146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 38731929 - 38731963
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38731929 |
aaaatagtccctgaccccacttttgtgatgatttg |
38731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 19184130 - 19184063
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
19184130 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaa |
19184063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 318
Target Start/End: Original strand, 40124987 - 40125016
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40124987 |
cctgcaaatatgcctcattttggttttagt |
40125016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 5790579 - 5790615
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
5790579 |
cctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 16900185 - 16900149
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
16900185 |
cctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 16993576 - 16993540
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
16993576 |
cctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 26814208 - 26814172
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26814208 |
cctgcaaatatgcctcgttttggttttagtccctggt |
26814172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 37271760 - 37271796
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
37271760 |
cctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 33)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 18473293 - 18473408
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
18473293 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
18473392 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
18473393 |
cttttgtgatgatttg |
18473408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 2733285 - 2733320
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2733285 |
gaaaatagtctctgaccccacttttgtgatgatttg |
2733320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 48955964 - 48955929
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955964 |
gaaaatagtctctgaccccacttttgtgatgatttg |
48955929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 24649452 - 24649486
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24649452 |
aaaatagtctctgaccccacttttgtgatgatttg |
24649486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 45290559 - 45290593
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45290559 |
aaaatagtctctgaccccacttttgtgatgatttg |
45290593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 32729028 - 32728913
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
32729028 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccatgacccca |
32728929 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32728928 |
cttttgtgatgatttg |
32728913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 405
Target Start/End: Original strand, 4323930 - 4323966
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttgt |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4323930 |
gaaaatagtccctgaccccacttttgtgatgatttgt |
4323966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 405
Target Start/End: Original strand, 14007588 - 14007624
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttgt |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14007588 |
gaaaatagtccctgaccccacttttgtgatgatttgt |
14007624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 990188 - 990223
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
990188 |
gaaaatagtccctgaccccacttttgtgatgatttg |
990223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 3679725 - 3679760
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3679725 |
gaaaatagtccctgaccccacttttgtgatgatttg |
3679760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 7001795 - 7001760
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7001795 |
gaaaatagtccctgaccccacttttgtgatgatttg |
7001760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 10552212 - 10552177
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10552212 |
gaaaatagtttctgaccccacttttgtgatgatttg |
10552177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 12361112 - 12361147
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12361112 |
gaaaatagtccctgaccccacttttgtgatgatttg |
12361147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 15335193 - 15335158
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15335193 |
gaaaatagtccctgaccccacttttgtgatgatttg |
15335158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 26142521 - 26142556
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26142521 |
gaaaatagtccctgaccccacttttgtgatgatttg |
26142556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 31258441 - 31258476
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31258441 |
gaaaatagtccctgaccccacttttgtgatgatttg |
31258476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 41358562 - 41358527
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41358562 |
gaaaatagtccctgaccccacttttgtgatgatttg |
41358527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 41881195 - 41881230
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41881195 |
gaaaatagtccctgaccccacttttgtgatgatttg |
41881230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 16026917 - 16026887
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16026917 |
cctgcaaatatgcctcattttggttttagtc |
16026887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 16060864 - 16060834
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16060864 |
cctgcaaatatgcctcattttggttttagtc |
16060834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 18302281 - 18302247
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18302281 |
aaaatagtctctgactccacttttgtgatgatttg |
18302247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 29688330 - 29688296
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29688330 |
aaaatagtcactgaccccacttttgtgatgatttg |
29688296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 403
Target Start/End: Complemental strand, 32626792 - 32626758
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgattt |
403 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
32626792 |
gaaaatagtccctgaccccacttttgtgatgattt |
32626758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 33234567 - 33234597
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33234567 |
cctgcaaatatgcctcattttggttttagtc |
33234597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 48609493 - 48609459
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48609493 |
aaaatagtctctgaccccatttttgtgatgatttg |
48609459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 50799151 - 50799181
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50799151 |
cctgcaaatatgcctcattttggttttagtc |
50799181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 990358 - 990291
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
990358 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccctgcaaaa |
990291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 7001876 - 7001840
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
7001876 |
cctgcaaatatgcctcgttttggttttagtccctggt |
7001840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 291 - 319
Target Start/End: Original strand, 18079421 - 18079449
Alignment:
| Q |
291 |
tgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18079421 |
tgcaaatatgcctcattttggttttagtc |
18079449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 404
Target Start/End: Complemental strand, 19198840 - 19198812
Alignment:
| Q |
376 |
gtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19198840 |
gtctctgaccccacttttgtgatgatttg |
19198812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 19622996 - 19622960
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
19622996 |
cctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 26061977 - 26062013
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26061977 |
cctgcaaatatgcctcgttttggttttagtccctggt |
26062013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 41358390 - 41358426
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
41358390 |
cctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 1542 - 1507
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1542 |
gaaaatagtctctgaccccacttttgtgatgatttg |
1507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 1623 - 1587
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1623 |
cctgcaaatatgcctcgttttggttttagtccctggt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 3191 - 3156
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3191 |
gaaaatagtctctgaccccacttttgtgatgatttg |
3156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 27)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 1163013 - 1163048
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163013 |
gaaaatagtctctgaccccacttttgtgatgatttg |
1163048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 24187668 - 24187703
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187668 |
gaaaatagtctctgaccccacttttgtgatgatttg |
24187703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 32040272 - 32040237
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32040272 |
gaaaatagtctctgaccccacttttgtgatgatttg |
32040237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 21125919 - 21125885
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21125919 |
aaaatagtctctgaccccacttttgtgatgatttg |
21125885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 1408253 - 1408218
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1408253 |
gaaaatagtcactgaccccacttttgtgatgatttg |
1408218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 1525911 - 1525946
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1525911 |
gaaaatagtccctgaccccacttttgtgatgatttg |
1525946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 4375791 - 4375826
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4375791 |
gaaaatagtccctgaccccacttttgtgatgatttg |
4375826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 6146847 - 6146812
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6146847 |
gaaaatagtccctgaccccacttttgtgatgatttg |
6146812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 14495299 - 14495264
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14495299 |
gaaaatagtccctgaccccacttttgtgatgatttg |
14495264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 18549305 - 18549340
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18549305 |
gaaaatagtctctgaccccatttttgtgatgatttg |
18549340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 19494220 - 19494255
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19494220 |
gaaaatagtccctgaccccacttttgtgatgatttg |
19494255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 21509796 - 21509831
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21509796 |
gaaaatagtccctgaccccacttttgtgatgatttg |
21509831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 22917826 - 22917791
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22917826 |
gaaaatagtccctgaccccacttttgtgatgatttg |
22917791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 24954910 - 24954875
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24954910 |
gaaaatagtccctgaccccacttttgtgatgatttg |
24954875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 33636424 - 33636459
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33636424 |
gaaaatagtccctgaccccacttttgtgatgatttg |
33636459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 38930403 - 38930438
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38930403 |
gaaaatagtccctgaccccacttttgtgatgatttg |
38930438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 40066595 - 40066630
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40066595 |
gaaaatagtctctgaccccacttttatgatgatttg |
40066630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 40493054 - 40493089
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40493054 |
gaaaatagtccctgaccccacttttgtgatgatttg |
40493089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 4017005 - 4017039
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4017005 |
aaaatagtccctgaccccacttttgtgatgatttg |
4017039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 14847846 - 14847876
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14847846 |
cctgcaaatatgcctcattttggttttagtc |
14847876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 24814726 - 24814756
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24814726 |
cctgcaaatatgcctcattttggttttagtc |
24814756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 32418577 - 32418543
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32418577 |
aaaatagtctctgaccccatttttgtgatgatttg |
32418543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 318
Target Start/End: Complemental strand, 13232541 - 13232512
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13232541 |
cctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 288 - 324
Target Start/End: Complemental strand, 10873201 - 10873165
Alignment:
| Q |
288 |
tcctgcaaatatgcctcattttggttttagtcgctgg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
10873201 |
tcctgcaaatatgcctcattttggttttggtccctgg |
10873165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 19494392 - 19494356
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
19494392 |
cctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 22917585 - 22917621
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
22917585 |
cctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 369 - 401
Target Start/End: Original strand, 32195381 - 32195413
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgat |
401 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
32195381 |
gaaaatagtctctgaccccacttttatgatgat |
32195413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 32)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 488814 - 488849
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
488814 |
gaaaatagtctctgaccccacttttgtgatgatttg |
488849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 5308586 - 5308551
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308586 |
gaaaatagtctctgaccccacttttgtgatgatttg |
5308551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 21223508 - 21223543
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21223508 |
gaaaatagtctctgaccccacttttgtgatgatttg |
21223543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 44403151 - 44403116
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44403151 |
gaaaatagtctctgaccccacttttgtgatgatttg |
44403116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 45073541 - 45073506
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45073541 |
gaaaatagtctctgaccccacttttgtgatgatttg |
45073506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 46304281 - 46304246
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304281 |
gaaaatagtctctgaccccacttttgtgatgatttg |
46304246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 370 - 404
Target Start/End: Original strand, 18311682 - 18311716
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18311682 |
aaaatagtctctgaccccacttttgtgatgatttg |
18311716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 370 - 404
Target Start/End: Complemental strand, 48358975 - 48358941
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48358975 |
aaaatagtctctgaccccacttttgtgatgatttg |
48358941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 14738621 - 14738735
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
14738621 |
cctgcaaatatgcctcattttggttttagtc-ctggtaaaaaaaaatttgtttttggtccttgcaaaattttttgtttttgaaaatagtctctaacccca |
14738719 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14738720 |
cttttgtgatgatttg |
14738735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 404
Target Start/End: Original strand, 44508741 - 44508855
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44508741 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaat-ttgtttttggtccctgcaaaaatttttgtttttgaaaatagtctctgacccca |
44508839 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
44508840 |
cttttgttatgatttg |
44508855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 1007128 - 1007093
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1007128 |
gaaaatagtccctgaccccacttttgtgatgatttg |
1007093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 1559605 - 1559570
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1559605 |
gaaaatagtccctgaccccacttttgtgatgatttg |
1559570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 6108596 - 6108561
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6108596 |
gaaaatagtccctgaccccacttttgtgatgatttg |
6108561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 7432053 - 7432088
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7432053 |
gaaaatagtccctgaccccacttttgtgatgatttg |
7432088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 370 - 405
Target Start/End: Complemental strand, 23816933 - 23816898
Alignment:
| Q |
370 |
aaaatagtctctgaccccacttttgtgatgatttgt |
405 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23816933 |
aaaatagtctctgaccccatttttgtgatgatttgt |
23816898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 25547390 - 25547355
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25547390 |
gaaaatagtctctgaccccatttttgtgatgatttg |
25547355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 28911679 - 28911714
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28911679 |
gaaaatagtccctgaccccacttttgtgatgatttg |
28911714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 30709425 - 30709460
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30709425 |
gaaaatagtccctgaccccacttttgtgatgatttg |
30709460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 37372804 - 37372769
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37372804 |
gaaaatagtccctgaccccacttttgtgatgatttg |
37372769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 39719455 - 39719490
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39719455 |
gaaaatagtccctgaccccacttttgtgatgatttg |
39719490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 45021597 - 45021632
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45021597 |
gaaaatagtccctgaccccacttttgtgatgatttg |
45021632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 16941031 - 16941001
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16941031 |
cctgcaaatatgcctcattttggttttagtc |
16941001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 19758038 - 19758008
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19758038 |
cctgcaaatatgcctcattttggttttagtc |
19758008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 35470259 - 35470229
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35470259 |
cctgcaaatatgcctcattttggttttagtc |
35470229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 41054155 - 41054125
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41054155 |
cctgcaaatatgcctcattttggttttagtc |
41054125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 41054215 - 41054185
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41054215 |
cctgcaaatatgcctcattttggttttagtc |
41054185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 403
Target Start/End: Complemental strand, 44344690 - 44344656
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgattt |
403 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
44344690 |
gaaaatagtcactgaccccacttttgtgatgattt |
44344656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 318
Target Start/End: Complemental strand, 45021835 - 45021806
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45021835 |
cctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 1006856 - 1006892
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1006856 |
cctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 6108355 - 6108391
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
6108355 |
cctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 404
Target Start/End: Complemental strand, 6847011 - 6846983
Alignment:
| Q |
376 |
gtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6847011 |
gtctctgaccccacttttgtgatgatttg |
6846983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 44509033 - 44508997
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
44509033 |
cctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 30)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 31037497 - 31037532
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31037497 |
gaaaatagtctctgaccccacttttgtgatgatttg |
31037532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 35167064 - 35167029
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167064 |
gaaaatagtctctgaccccacttttgtgatgatttg |
35167029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 37090640 - 37090605
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37090640 |
gaaaatagtctctgaccccacttttgtgatgatttg |
37090605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 38496521 - 38496556
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38496521 |
gaaaatagtctctgaccccacttttgtgatgatttg |
38496556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 294091 - 294056
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
294091 |
gaaaatagtccctgaccccacttttgtgatgatttg |
294056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 2217756 - 2217721
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2217756 |
gaaaatagtccctgaccccacttttgtgatgatttg |
2217721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 4203554 - 4203589
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4203554 |
gaaaatagtccctgaccccacttttgtgatgatttg |
4203589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 5950274 - 5950309
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5950274 |
gaaaatagtctttgaccccacttttgtgatgatttg |
5950309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 6118393 - 6118358
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6118393 |
gaaaatagtccctgaccccacttttgtgatgatttg |
6118358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 15635477 - 15635512
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15635477 |
gaaaatagtccctgaccccacttttgtgatgatttg |
15635512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 16038638 - 16038603
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16038638 |
gaaaatagtctctgaccccacttttgtgattatttg |
16038603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 18046250 - 18046215
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18046250 |
gaaaatagtctctgaccccacttttgtgataatttg |
18046215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 18633859 - 18633824
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18633859 |
gaaaatagtccctgaccccacttttgtgatgatttg |
18633824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 23382208 - 23382173
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23382208 |
gaaaatagtccctgaccccacttttgtgatgatttg |
23382173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 25779060 - 25779025
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25779060 |
gaaaatagtccctgaccccacttttgtgatgatttg |
25779025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 29151618 - 29151653
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29151618 |
gaaaatagtccctgaccccacttttgtgatgatttg |
29151653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 30888262 - 30888297
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30888262 |
gaaaatagtccctgaccccacttttgtgatgatttg |
30888297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 35166058 - 35166023
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35166058 |
gaaaatagtccctgaccccacttttgtgatgatttg |
35166023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 38962992 - 38962957
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38962992 |
gaaaatagtccctgaccccacttttgtgatgatttg |
38962957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 42207342 - 42207377
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42207342 |
gaaaatagtccctgaccccacttttgtgatgatttg |
42207377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 24443401 - 24443431
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24443401 |
cctgcaaatatgcctcattttggttttagtc |
24443431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 374 - 404
Target Start/End: Original strand, 26071397 - 26071427
Alignment:
| Q |
374 |
tagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26071397 |
tagtctctgaccccacttttgtgatgatttg |
26071427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Original strand, 28213394 - 28213424
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28213394 |
cctgcaaatatgcctcattttggttttagtc |
28213424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 38555063 - 38555033
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38555063 |
cctgcaaatatgcctcattttggttttagtc |
38555033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Original strand, 18633620 - 18633687
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
18633620 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaa |
18633687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 29172865 - 29172798
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaa |
356 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
29172865 |
cctgcaaatatgcctcgttttggttttagtccctggtaaaaaagaatttgtttttggtccctgcaaaa |
29172798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 29172544 - 29172580
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
29172544 |
cctgcaaatatgcctcgttttggttttagtccctggt |
29172580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 29875421 - 29875457
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
29875421 |
cctgcaaatatgcctcgttttggttttagtccctggt |
29875457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Complemental strand, 29875704 - 29875668
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
29875704 |
cctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 39379260 - 39379296
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39379260 |
cctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 289 - 404
Target Start/End: Complemental strand, 268 - 153
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggtnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnngaaaatagtctctgacccca |
388 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
268 |
cctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccctgcaaaattttttgtttttgaaaatagtccctgacccca |
169 |
T |
 |
| Q |
389 |
cttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
168 |
cttttgtgatgatttg |
153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 369 - 405
Target Start/End: Original strand, 12284 - 12320
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttgt |
405 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12284 |
gaaaatagtccctgaccccacttttgtgatgatttgt |
12320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 5311 - 5346
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5311 |
gaaaatagtcactgaccccacttttgtgatgatttg |
5346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 5331 - 5366
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5331 |
gaaaatagtcactgaccccacttttgtgatgatttg |
5366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Complemental strand, 17942 - 17907
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17942 |
gaaaatagtccctgaccccacttttgtgatgatttg |
17907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 369 - 404
Target Start/End: Original strand, 10257 - 10292
Alignment:
| Q |
369 |
gaaaatagtctctgaccccacttttgtgatgatttg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10257 |
gaaaatagtccctgaccccacttttgtgatgatttg |
10292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 319
Target Start/End: Complemental strand, 48210 - 48180
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48210 |
cctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 8568 - 8604
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
8568 |
cctgcaaatatgcctcgttttggttttagtccctggt |
8604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 34952 - 34988
Alignment:
| Q |
289 |
cctgcaaatatgcctcattttggttttagtcgctggt |
325 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
34952 |
cctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University