View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15462_low_6 (Length: 325)
Name: NF15462_low_6
Description: NF15462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15462_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 48690045 - 48689819
Alignment:
| Q |
13 |
gagatgaagtagtaaaaaggggaggtggtaataggggagaggatataagaaagatgggccgagtgaatagatgagatagttgtttgtttgtctgtttgtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48690045 |
gagatgaagtagtaaaaaggggaggtggtaataggggagaggatataagaaagatgggccgagtgaatagatgagatagttgtttgtttgtctgtttgtt |
48689946 |
T |
|
| Q |
113 |
attcacaatcacagagaacgaaccgaaggaagcaaaacgttatcctcttctctggtttggtttccatcgaatcccaccattacc-aaaatccttctttcc |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48689945 |
attcacaataacagagaacgaaccgaaggaagcaaaacgttatcctcttctctggtttggtttacatcgaatcccaccattaccaaaaatccttctttcc |
48689846 |
T |
|
| Q |
212 |
ttcatgctcttctcttgtttgttattc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
48689845 |
ttcatgctcttctcttgtttgtcattc |
48689819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 308
Target Start/End: Complemental strand, 48689802 - 48689751
Alignment:
| Q |
261 |
tttctctcactatcgctcgctcgct----gaatgagcccccatgcctttgat |
308 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48689802 |
tttctctcactatcgctcgctcgctcgctgaatgagcccccatgcctttgat |
48689751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University