View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15464_high_9 (Length: 285)
Name: NF15464_high_9
Description: NF15464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15464_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 34315823 - 34315556
Alignment:
| Q |
14 |
atatatacctatatatgatgcaataataaaggcaacttgttcacatgctactttggcattttaatagaaaatacttaatttagcaagcaagaattgcata |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34315823 |
atatatacccatatatgatgcaataataaaggcaacttgttcacatgctactttggcattttaatagaaaatacttaattaagcaagcaagaattgcata |
34315724 |
T |
 |
| Q |
114 |
tgcaactttcattcatgaaaattctaaatacc-ttgggtctggtctattcaaaccagtcttttgaagctagnnnnnnnggtaactattgtctatctcttg |
212 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
34315723 |
tgcaacattcattcataaaaattctaaatacctttgggtctggtctattcaaaccagtcttttgaagctagtttttttgataactattgtctatctcttg |
34315624 |
T |
 |
| Q |
213 |
taaaaactaattgataacatggattagagggatgccatctttctctcaaatgtagataaatttttgaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34315623 |
taaaaactaattgataacatggattagagggatgccatctttctctcaaatgtagataaatttttgaa |
34315556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University