View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_26 (Length: 467)
Name: NF15465_high_26
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 8e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 8e-93
Query Start/End: Original strand, 23 - 268
Target Start/End: Original strand, 26516274 - 26516506
Alignment:
| Q |
23 |
ttgaagacataatttaagcaaaatgtcaaagcgattatcagcttagaatcacagttatgttatacaaatggtaaaaactaaatcgaatggtcgccttgtc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26516274 |
ttgaagacataatttaagcaaaatgtcaaagcgattatcagcttagaatcacagttatgt-------------aagactaaatcgaatggtcgccttgtc |
26516360 |
T |
|
| Q |
123 |
ccatggcagtgtaggctacttatttagtttttaatttaccaacttacaagaataggcaaacggcgatttaatctgcannnnnnnatttcttgtgattttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
26516361 |
ccatggcagtgtaggctacttatttagtttttaatttaccaacttacaagaataggcaaacggcgatttaatctgcatttttttatttcttgtaattttt |
26516460 |
T |
|
| Q |
223 |
ggattgttggtggtgtgaacagaacaattaacatgtgattttggat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26516461 |
ggattgttggtggtgtgaacagaacaattaacatgtgattttggat |
26516506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University