View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15465_high_36 (Length: 404)

Name: NF15465_high_36
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15465_high_36
NF15465_high_36
[»] chr4 (6 HSPs)
chr4 (20-271)||(55728891-55729142)
chr4 (20-235)||(38093444-38093658)
chr4 (32-228)||(6410099-6410296)
chr4 (353-397)||(55728765-55728809)
chr4 (356-397)||(38093288-38093329)
chr4 (144-216)||(24957536-24957608)
[»] chr5 (2 HSPs)
chr5 (24-270)||(12156555-12156801)
chr5 (353-397)||(12156428-12156472)
[»] chr1 (3 HSPs)
chr1 (22-271)||(14350767-14351018)
chr1 (58-218)||(32058777-32058936)
chr1 (354-397)||(14351110-14351153)
[»] chr2 (2 HSPs)
chr2 (104-271)||(14950161-14950328)
chr2 (51-269)||(38531038-38531259)
[»] scaffold0044 (1 HSPs)
scaffold0044 (20-235)||(42536-42750)
[»] chr6 (1 HSPs)
chr6 (32-211)||(30845666-30845845)
[»] chr8 (1 HSPs)
chr8 (355-392)||(15050134-15050171)
[»] chr7 (1 HSPs)
chr7 (185-221)||(3302690-3302726)


Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 20 - 271
Target Start/End: Complemental strand, 55729142 - 55728891
Alignment:
20 cttgtacggtgattttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggct 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
55729142 cttgtacggtgattttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgatagttcaacaccgatggct 55729043  T
120 tgagtttgtcttttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgataga 219  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55729042 tgagtttgtcttttcggtatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgataga 55728943  T
220 tctgtcacgtggtgatatgtgtctgcatatgatttgttatgattttgatgaa 271  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||    
55728942 tcggtcacgtggtgatatgtgtctgcatatgatttgttatgattttgatgaa 55728891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 38093658 - 38093444
Alignment:
20 cttgtacggtgattttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggct 119  Q
    ||||||| ||| |||||||||||||| |    ||||| ||||||||||||||||||||||||||  | |||  ||||| | | |||||||||||||| ||    
38093658 cttgtacagtggttttggcggtggtttcggcagtcgacctcttgtggagtcgtgaaatgtgttggag-tctggttctccggccgttcaacaccgatgact 38093560  T
120 tgagtttgtcttttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgataga 219  Q
    || ||||||||||| | |||| | |||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||  ||||| ||    
38093559 tgtgtttgtctttttggtatgtggtggttgatatcagatccgttttctttcttggcggtggatgtaggttttgtttgctcgcaacgtgggcagtgatgga 38093460  T
220 tctgtcacgtggtgat 235  Q
    || |||||||||||||    
38093459 tcggtcacgtggtgat 38093444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 32 - 228
Target Start/End: Complemental strand, 6410296 - 6410099
Alignment:
32 ttttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggcttgagttt--gtc 129  Q
    |||||||||||||||||  |||||| ||||||||| |||||||| |||||||| ||||| |||||||| | ||||||| | |||||| ||| |||  |||    
6410296 ttttggcggtggttccagcggtcgacctcttgtggggtcgtgaattgtgttgcagctctgtttctctggccgttcaactctgatggcctgatttttcgtc 6410197  T
130 ttttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgatagatctgtcacg 228  Q
    |||| | |  | | ||| |||||  |||| |  ||||| |||||  |||||||| ||||| |||||||||||||  ||||||||||| |||| ||||||    
6410196 tttt-gttgcgtggtggctgatacaagattcaatttctctcttggtggtggatggaggttatgtttgctcgcaaaataggtggtgatggatcggtcacg 6410099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 353 - 397
Target Start/End: Complemental strand, 55728809 - 55728765
Alignment:
353 gatggtgatgctcgtggtggccggtgttagtttttggtgatgatg 397  Q
    ||||||||||||||||||||||||||||||||||||||| |||||    
55728809 gatggtgatgctcgtggtggccggtgttagtttttggtggtgatg 55728765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 356 - 397
Target Start/End: Complemental strand, 38093329 - 38093288
Alignment:
356 ggtgatgctcgtggtggccggtgttagtttttggtgatgatg 397  Q
    |||||||||||||||||| ||||||||||||||||| |||||    
38093329 ggtgatgctcgtggtggctggtgttagtttttggtggtgatg 38093288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 144 - 216
Target Start/End: Original strand, 24957536 - 24957608
Alignment:
144 tggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgat 216  Q
    |||||||||| ||||  | |||||||||||  ||||| || ||||| |||||||||||||| |||||||||||    
24957536 tggttgatatcagatttgttttctttcttggaggtgggtggaggttatgtttgctcgcaacataggtggtgat 24957608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 24 - 270
Target Start/End: Complemental strand, 12156801 - 12156555
Alignment:
24 tacggtgattttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggcttgag 123  Q
    ||||||| |||||||||||||||| |   ||||||||||||||||||||||||||| | ||| |||| |||||||| | |||||||||||||||||||||    
12156801 tacggtggttttggcggtggttccgactatcgatctcttgtggagtcgtgaaatgtatcgcgactctgtttctctggccgttcaacaccgatggcttgag 12156702  T
124 tttgtcttttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgatagatctg 223  Q
    |||||||||| | |||||| |||||||||| ||||| | |||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||| |    
12156701 tttgtctttttggtatgcggtggttgatatcagatctgttttctttcttgacggtggatgtaggttttgtttgcttgcaatgtaggtggtgatggatcag 12156602  T
224 tcacgtggtgatatgtgtctgcatatgatttgttatgattttgatga 270  Q
    |||||||||||| |||||||||||||||| | ||||| |||||||||    
12156601 tcacgtggtgatgtgtgtctgcatatgatctattatggttttgatga 12156555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 353 - 397
Target Start/End: Complemental strand, 12156472 - 12156428
Alignment:
353 gatggtgatgctcgtggtggccggtgttagtttttggtgatgatg 397  Q
    |||||||||||| |||||||| ||||||||||||||||| |||||    
12156472 gatggtgatgcttgtggtggctggtgttagtttttggtggtgatg 12156428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 121; Significance: 7e-62; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 22 - 271
Target Start/End: Original strand, 14350767 - 14351018
Alignment:
22 tgtacggtgattttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggcttg 121  Q
    ||||||||| |||||||||| ||||| |   ||||||||||||||||||||||||||| |  || |||| |||||||| | |||||||| ||||||||||    
14350767 tgtacggtggttttggcggttgttccgactatcgatctcttgtggagtcgtgaaatgtatcacgactctgtttctctggccgttcaacatcgatggcttg 14350866  T
122 agtttgtcttttcgatatgcgatggttgatattagatccg--ctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgataga 219  Q
    |||||||||||| | |||||| |||||||||||||||| |   ||| |||||||||||||||||||||||||| | |||||||| |||||||||||||||    
14350867 agtttgtctttttggtatgcggtggttgatattagatctgttttttttttcttgacggtggatgtaggttttgctcgctcgcaatgtaggtggtgataga 14350966  T
220 tctgtcacgtggtgatatgtgtctgcatatgatttgttatgattttgatgaa 271  Q
    ||  |||||||||||| ||||||||| |||||| | ||||| ||||||||||    
14350967 tcgatcacgtggtgatgtgtgtctgcgtatgatctattatggttttgatgaa 14351018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 58 - 218
Target Start/End: Complemental strand, 32058936 - 32058777
Alignment:
58 ctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggcttgagtttgtcttttcgatatgcgatggttgatattaga 157  Q
    |||| ||||||| ||||| |||||| ||||||| |||||||| | ||||||||| ||| ||||||||||||||||| | |||| | |||||||||  |||    
32058936 ctctggtggagttgtgaattgtgttacggctctgtttctctggccgttcaacactgattgcttgagtttgtcttttgg-tatgtggtggttgataccaga 32058838  T
158 tccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgatag 218  Q
    |||| ||||| |||||||||||| || ||||| ||||||||||||||||||||||||||||    
32058837 tccgttttctctcttgacggtgggtgaaggttctgtttgctcgcaacgtaggtggtgatag 32058777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 354 - 397
Target Start/End: Original strand, 14351110 - 14351153
Alignment:
354 atggtgatgctcgtggtggccggtgttagtttttggtgatgatg 397  Q
    |||||||||||||||||||| ||||||||||||||||| |||||    
14351110 atggtgatgctcgtggtggctggtgttagtttttggtggtgatg 14351153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 104 - 271
Target Start/End: Original strand, 14950161 - 14950328
Alignment:
104 ttcaacaccgatggcttgagtttgtcttttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaa 203  Q
    |||||||||||||||||||||||||||||| | |||||| |||||||||  ||||||| |||||||||||||||||||||||||||||||||||| || |    
14950161 ttcaacaccgatggcttgagtttgtctttttggtatgcggtggttgataccagatccgttttctttcttgacggtggatgtaggttttgtttgcttgcga 14950260  T
204 cgtaggtggtgatagatctgtcacgtggtgatatgtgtctgcatatgatttgttatgattttgatgaa 271  Q
    ||||||||||||| |||| ||||||||||||| ||| ||||||||| || ||||||| ||||||||||    
14950261 cgtaggtggtgatggatcggtcacgtggtgatctgtatctgcatattatctgttatggttttgatgaa 14950328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 51 - 269
Target Start/End: Original strand, 38531038 - 38531259
Alignment:
51 ggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggcttgagtttgtcttttcgatatgcgatggttga 150  Q
    |||||| |||||||||||||||||||| |||||| | | | |||||||| | ||||||||||||||||||||||||||||||| | |||| | |||||||    
38531038 ggtcgacctcttgtggagtcgtgaaatatgttgcagttttgtttctctgtc-gttcaacaccgatggcttgagtttgtctttttggtatgtggtggttga 38531136  T
151 tattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgatagatctgtcac----gtggtgatatgtgtctgca 246  Q
    ||  ||||| | |||||||||||  |||||||| |||||||||||| ||||||| || |||||||| |||| || ||    |||||||| ||||||||||    
38531137 taccagatctgttttctttcttggtggtggatggaggttttgtttgttcgcaacatatgtggtgatggatcggttacgaaagtggtgatctgtgtctgca 38531236  T
247 tatgatttgttatgattttgatg 269  Q
    |||||| ||||||| ||||||||    
38531237 tatgatctgttatggttttgatg 38531259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 42536 - 42750
Alignment:
20 cttgtacggtgattttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctctgacagttcaacaccgatggct 119  Q
    ||||||| ||| |||||||||||||| |  | ||||| ||||||||||||||||||||||||||||  | |  ||||| | |  ||||||| ||||| ||    
42536 cttgtacagtggttttggcggtggtttcggaagtcgacctcttgtggagtcgtgaaatgtgttgcgagtatggttctccggccattcaacagcgatgact 42635  T
120 tgagtttgtcttttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtggtgataga 219  Q
    || ||||||||||| | |||    |||||||||| ||||||| ||||||||||| | |||||||||||||| |||||||| |||| | ||| ||||| ||    
42636 tgtgtttgtctttttggtatatcgtggttgatatcagatccgttttctttcttggccgtggatgtaggtttagtttgctcccaac-tgggtagtgatgga 42734  T
220 tctgtcacgtggtgat 235  Q
    || |||||||||||||    
42735 tcggtcacgtggtgat 42750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 32 - 211
Target Start/End: Complemental strand, 30845845 - 30845666
Alignment:
32 ttttggcggtggttccaaaggtcgatctcttgtggagtcgtgaaatgtgttgcggctctatttctct-gacagttcaacaccgatggcttgagtttgtct 130  Q
    |||||| ||||||||| |  ||||| |||||||||||||||||| ||||||  |||||||||||||| | || ||| |||  ||||||||||| ||||||    
30845845 ttttggtggtggttccgacagtcgacctcttgtggagtcgtgaattgtgttatggctctatttctcttgtca-ttcgacattgatggcttgagattgtct 30845747  T
131 tttcgatatgcgatggttgatattagatccgctttctttcttgacggtggatgtaggttttgtttgctcgcaacgtaggtg 211  Q
    ||| | |||| | |||||||||  | ||  | ||||| ||||| ||||||||| ||||||||||| |||||||| ||||||    
30845746 ttttggtatggggtggttgataacatatatgttttctctcttggcggtggatgaaggttttgttttctcgcaacataggtg 30845666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 355 - 392
Target Start/End: Original strand, 15050134 - 15050171
Alignment:
355 tggtgatgctcgtggtggccggtgttagtttttggtga 392  Q
    ||||||||||||||||||| |||| |||||||||||||    
15050134 tggtgatgctcgtggtggctggtgctagtttttggtga 15050171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 3302726 - 3302690
Alignment:
185 aggttttgtttgctcgcaacgtaggtggtgatagatc 221  Q
    ||||| |||||||||||||| ||||||||||||||||    
3302726 aggttatgtttgctcgcaacataggtggtgatagatc 3302690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University