View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_38 (Length: 399)
Name: NF15465_high_38
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_38 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 19 - 399
Target Start/End: Original strand, 53278399 - 53278779
Alignment:
| Q |
19 |
ctttgtgtgtgtcttgagctatttttgttgataattgtaatattannnnnnnggtgggatggatgtagatatggtgatggtgagccaactgataatgccg |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278399 |
ctttgtgtgtgtcttcagctatttttgttgataattgtaatattatttttttggtgggatggatgtagatatggtgatggtgagccaactgataatgccg |
53278498 |
T |
|
| Q |
119 |
cgagattttataaatggttcgaggtaagattgatatagattatgtagtttctttgatattgggtgtgagattattagtgttgggtttgtatatttattgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278499 |
cgagattttataaatggttcgaggtaagattgatatagattatgtagtttctttgatattgggtgtgagattattagtgttgggtttgtatatttattgc |
53278598 |
T |
|
| Q |
219 |
gtgattgtgattttgatttcaggaatttgaaggggaagaagattcgtttaagaatcttcagtatggtgtgtttggacttgggaacagacagtatgagcat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278599 |
gtgattgtgattttgatttcaggaatttgaaggggaagaagattcgtttaagaatcttcagtatggtgtgtttggacttgggaacagacagtatgagcat |
53278698 |
T |
|
| Q |
319 |
tttaataaggtttgcactcaagcccttatgcattcttgtggttttctaagctttgactatagtgatggtgttgctagtttc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278699 |
tttaataaggtttgcactcaagcccttatgcattcttgtggttttctaagctttgactatagtgatggtgttgctagtttc |
53278779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 88 - 137
Target Start/End: Original strand, 46020355 - 46020404
Alignment:
| Q |
88 |
tatggtgatggtgagccaactgataatgccgcgagattttataaatggtt |
137 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
46020355 |
tatggagatggagagccaactgacaatgccgcaagattctataaatggtt |
46020404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University