View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_68 (Length: 287)
Name: NF15465_high_68
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 38414395 - 38414598
Alignment:
| Q |
14 |
tagagttggtaccttttgaattgagcacagagaaacgaaagagtgagtgacaaaggcgaaagttgttttctgcagaaacnnnnnnncgattacaaattgt |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
38414395 |
tagagttagtaccttttgaattgagcacagagaaacgaaagagtgagtgacaaaggcgaaggttgttttctgcagaaacaaaaaaacgattacaaattgt |
38414494 |
T |
 |
| Q |
114 |
taagaacaaaaaagagcaggggtgtgagagaagccagtaacatacatttgacgacggatgcagtttgacggcgattcagggaaagagggatagggtgcgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38414495 |
taagaacaaaaaagagcaggggtgtgagagaagccagtaacatacctttgacgacggatgcag-ttgacggcgattcagagaaagagggatagggtgcgg |
38414593 |
T |
 |
| Q |
214 |
tggcg |
218 |
Q |
| |
|
||||| |
|
|
| T |
38414594 |
tggcg |
38414598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University