View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15465_high_68 (Length: 287)

Name: NF15465_high_68
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15465_high_68
NF15465_high_68
[»] chr3 (1 HSPs)
chr3 (14-218)||(38414395-38414598)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 38414395 - 38414598
Alignment:
14 tagagttggtaccttttgaattgagcacagagaaacgaaagagtgagtgacaaaggcgaaagttgttttctgcagaaacnnnnnnncgattacaaattgt 113  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||       ||||||||||||||    
38414395 tagagttagtaccttttgaattgagcacagagaaacgaaagagtgagtgacaaaggcgaaggttgttttctgcagaaacaaaaaaacgattacaaattgt 38414494  T
114 taagaacaaaaaagagcaggggtgtgagagaagccagtaacatacatttgacgacggatgcagtttgacggcgattcagggaaagagggatagggtgcgg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
38414495 taagaacaaaaaagagcaggggtgtgagagaagccagtaacatacctttgacgacggatgcag-ttgacggcgattcagagaaagagggatagggtgcgg 38414593  T
214 tggcg 218  Q
    |||||    
38414594 tggcg 38414598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University