View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_69 (Length: 287)
Name: NF15465_high_69
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 40648815 - 40648624
Alignment:
| Q |
19 |
agtactcgaagtaaaattgcacatcacaattgatcccttgatattttatacgaaataaaatctcctagatcctgtgatgataatgaactaatgagtagtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40648815 |
agtactcgaagtaaaattgcacatcacaattgatcccttgatattttatacgaaataaaatctcctagatcctgtgatgataatgaactaatgaggagtt |
40648716 |
T |
 |
| Q |
119 |
catttaattcaaatcgtaccttttgtttcatggtagcatgatcaatacccgttaaacccgtagcttttgttgcagctgcagagctcttgtca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648715 |
catttaattcaaatcgtaccttttgtttcatggtagcatgatcaatacccgtaaaacccgtagcttttgttgcagctgcagagctcttgtca |
40648624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 208 - 282
Target Start/End: Complemental strand, 40648593 - 40648519
Alignment:
| Q |
208 |
tcaggtggaggcacaaacgagtgagtctcaggacctctataatcgatctcataaatttctgtatcctatgcttct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40648593 |
tcaggtggaggcacaaacgagtgagtctcaggacctctataatcgatctcataaatttctgtatccaatgcttct |
40648519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University