View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_7 (Length: 720)
Name: NF15465_high_7
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_7 |
 | |
|
| [»] scaffold0288 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0288 (Bit Score: 115; Significance: 5e-58; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 115; E-Value: 5e-58
Query Start/End: Original strand, 567 - 716
Target Start/End: Original strand, 11278 - 11425
Alignment:
| Q |
567 |
ctgctaagtgttatttagtgatttcaaaagagagatgacaaaaagatatgaattaagaaacatcactcaattcacattgtccaacgaaatatttgcctta |
666 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11278 |
ctgctaagtgctatttagtgacttcaaaagagaga--aaaaaaagatatgaattaagaaacatcactcaattcacattgtccaacgaaatatttacctta |
11375 |
T |
|
| Q |
667 |
tcaaatgcattgaacacatcatccttgacaatttcaatatgtatctctgc |
716 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11376 |
taaaatgcattgaacacatcatccttgacaatttcactatgtatctctgc |
11425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 97 - 196
Target Start/End: Complemental strand, 38794675 - 38794574
Alignment:
| Q |
97 |
ctacctccttagagacctcttgggctttctttgatgatcttgcacagttgacc-aaacctg-taatataaagtccctgtagcagaacatcaggatccaaa |
194 |
Q |
| |
|
|||||||||| || ||||||| |||| ||| |||||||||||| |||||||| ||||||| ||||| |||||| |||| | ||||||||||||||||| |
|
|
| T |
38794675 |
ctacctccttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaacctgaaaatattaagtccatgtaaccgaacatcaggatccaaa |
38794576 |
T |
|
| Q |
195 |
ag |
196 |
Q |
| |
|
|| |
|
|
| T |
38794575 |
ag |
38794574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University