View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_74 (Length: 278)
Name: NF15465_high_74
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 40181806 - 40182079
Alignment:
| Q |
1 |
aaacgagggattacatgaagtggatgatgatgatgattgacttagaaagttggagaaaatgaccttgttagggttaggaattcttcgtgtggatgatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181806 |
aaacgagggattacatgaagtggatgatgatgatgattgacttagaaagttggagaaaatgaccttgttagggttaggaattcttcgtgtggatgatgat |
40181905 |
T |
|
| Q |
101 |
gaggaggaag------aagaagaagtgatgtagttcctgccatatcttgctgcaaacgacacccacatcttcttatatatagtttgcgagtgagaatcgg |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
40181906 |
aaggaggaagaagaagaagaagaagtgatgtagttcctgccatatcttgctgcaaacgacacccacatctgcatatatatagtttgcgagtgagaatcgg |
40182005 |
T |
|
| Q |
195 |
ttggagacaaacggcacacacacggctaggtttaggtttactgagcgattgagaatgttgaactctaacctatg |
268 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182006 |
ttggagacagacggcacacacacggctaggtttaggtttactgagcgattgagaatgttgaactctaacctatg |
40182079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University