View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_87 (Length: 246)
Name: NF15465_high_87
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_87 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 24975331 - 24975124
Alignment:
| Q |
20 |
aacttccttcaccgctttctccacctccacagctgccgcggaagaagaatctctatcttccaccgttcatccttggcctgaatggatctcgttcgttgat |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24975331 |
aacttccttctccgctttctccacctccaccgctgccgcggaagaagaatctctatcttccaccgttcatccttggcctgaatggatctcgttcgtcgat |
24975232 |
T |
|
| Q |
120 |
cgattaagagctaaaggctatctctctaaatcggctgatgataacagtgtttactctaatatcaatctcttgaaagatgcttctctttccttcgctcgtg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24975231 |
cgattaagagctaaaggctatctctctaaatcggctgatgataacagtgtttactctgatatcaatctcttgaaagatgcttctctttccttcgctcgtg |
24975132 |
T |
|
| Q |
220 |
accgttac |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
24975131 |
accgttac |
24975124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University