View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_high_99 (Length: 233)
Name: NF15465_high_99
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_high_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 14871387 - 14871175
Alignment:
| Q |
1 |
tttttgcatagaacgatcaagttaaataacaagactaattatatttttattttgataattaattcattgaaataagctcccaacaacgattttgctttga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14871387 |
tttttgcacagaacgatcaagttaaataacaagactaattatatttttattttgataattaattcattgaaataagctcccaacaacgattttgctttga |
14871288 |
T |
 |
| Q |
101 |
tttggcattgaacgcatccacatgagaaatccatccaccttcttcattccgattattcatggaagcagctgcagaaagatccaatccaaccatgcgctgc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14871287 |
tttggcattgaacacatccacatgagaaatccatccaccttcttcattccg---attcatggaagcagctgcagaaagatccaatccaaccatgcgctgc |
14871191 |
T |
 |
| Q |
201 |
ggttgtaggcgaggtg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14871190 |
ggttgtaggcgaggtg |
14871175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University